Human IL28B(Interleukin 28B) ELISA Kit

Human Interleukin 28B (IL28B) ELISA Kit

RDR-IL28B-Hu-48Tests 48 Tests
EUR 481

Human Interleukin 28B (IL28B) ELISA Kit

RDR-IL28B-Hu-96Tests 96 Tests
EUR 665

Human Interleukin 28B (IL28B) ELISA Kit

RD-IL28B-Hu-48Tests 48 Tests
EUR 460

Human Interleukin 28B (IL28B) ELISA Kit

RD-IL28B-Hu-96Tests 96 Tests
EUR 636

Human Interleukin 28B (IL28B) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 28B (IL28B) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 28B (IL28B) ELISA Kit

abx251386-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human IL28B/ Interleukin-28B ELISA Kit

E2925Hu 1 Kit
EUR 605

Human Interleukin- 28B, IL28B ELISA KIT

ELI-06518h 96 Tests
EUR 824

Human Interleukin 28B (IL28B) ELISA Kit

SEC028Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit

SEC028Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit

SEC028Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit

SEC028Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3
  • Interferon, Lambda 3
  • Cytokine Zcyto22
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 28B (IL28B) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Active Interleukin 28B (IL28B)

  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • EUR 996.00
  • EUR 1892.00
  • EUR 610.00
  • EUR 6820.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.6kDa
  • Isoelectric Point: 9
Description: Recombinant Human Interleukin 28B expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Interleukin 28B (IL28B) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin 28B (IL28B) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-15 working days.

Interleukin 28B (IL28B) Antibody

abx029111-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Interleukin 28B (IL28B) Antibody

abx029111-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mouse Interleukin- 28B, Il28b ELISA KIT

ELI-06519m 96 Tests
EUR 865

Human Interleukin 28B (IL28B) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Interleukin 28B (IL28B)CLIA Kit

SCC028Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B)CLIA Kit

SCC028Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B)CLIA Kit

SCC028Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B)CLIA Kit

SCC028Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 28B Clia kit. Alternative names of the recognized antigen: IFNL3
  • Interferon, Lambda 3
  • Cytokine Zcyto22
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B)serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids

ELISA kit for Human IL28B (Interleukin 28B)

ELK1783 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 28B (IL28B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki
  • Show more
Description: A sandwich ELISA kit for detection of Interleukin 28B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Interleukin 28B (IL28B) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Interleukin 28B (IL28B) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Interleukin 28B (IL28B) Protein (Active)

  • EUR 1121.00
  • EUR 411.00
  • EUR 3724.00
  • EUR 1358.00
  • EUR 759.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 28B (IL28B) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B)

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit

HEC028Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit

HEC028Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit

HEC028Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit

HEC028Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3
  • Interferon, Lambda 3
  • Cytokine Zcyto22
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Interleukin 28B (IL28B) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit

MEC028Mu-10x96wellstestplate 10x96-wells test plate
EUR 5804.88
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit

MEC028Mu-1x48wellstestplate 1x48-wells test plate
EUR 565.7
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit

MEC028Mu-1x96wellstestplate 1x96-wells test plate
EUR 765.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit

MEC028Mu-5x96wellstestplate 5x96-wells test plate
EUR 3143.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit

  • EUR 5855.00
  • EUR 3094.00
  • EUR 766.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3
  • Interferon, Lambda 3
  • Cytokine Zcyto22
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 28B (IL28B) in samples from n/a with no significant corss-reactivity with analogues from other species.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with APC.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with Biotin.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with Cy3.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with FITC.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with HRP.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with PE.

Recombinant Human IFNL3/IL28B/Interleukin-28B Protein

RP00219 5 μg
EUR 155

IL28B Human, Interleukin 28B Human Recombinant Protein, Sf9

PROTQ8IZI9-1 Regular: 10ug
EUR 317
Description: IL 28B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (22-196 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 181 amino acids and having a molecular mass of 20.4kDa.;IL 28B shows multiple bands between 18-28kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), APC-Cy7

  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with APC-Cy7.

Human Interleukin 28B,IL-28B ELISA Kit

201-12-0042 96 tests
EUR 440
  • This Interleukin 28B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human IL-28B(Interleukin-28B) ELISA Kit

EH2057 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q8IZI9
  • Alias: IL28B(Interleukin-28B)/IL-28B/Interleukin-28C/IL-28C/Interferon lambda-4/IFN-lambda-4/Cytokine Zcyto22/Interferon lambda-3/IFN-lambda-3/IL28C/IL-28B/interferon, lambda 3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin 28B(IL-28B) ELISA kit

CSB-E13296h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28B (IL-28B) in samples from serum, plasma, cellculturesupernats, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 28B(IL-28B) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28B(IL-28B) in samples from serum, plasma, cellculturesupernats, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 28B(IL-28B)ELISA Kit

GA-E0089HM-48T 48T
EUR 289

Human Interleukin 28B(IL-28B)ELISA Kit

GA-E0089HM-96T 96T
EUR 466

Human Interleukin 28B(IL-28B)ELISA Kit

QY-E04282 96T
EUR 361

ELISA kit for Human IL-28B (Interleukin 28B)

E-EL-H5508 1 plate of 96 wells
EUR 534
  • Gentaur's IL-28B ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-28B. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-28B (Interleukin 28B) in samples from Serum, Plasma, Cell supernatant

Porcine Interleukin 28B, IL- 28B ELISA Kit

ELA-E2028p 96 Tests
EUR 928

IL-28B Interleukin-28B Human Recombinant Protein

PROTQ8IZI9 Regular: 10ug
EUR 317
Description: Interleukin-28B Human Recombinant produced in HEK cells is a non-glycosylated monomer, having a total molecular weight of 24kDa.;The IL28B is purified by proprietary chromatographic techniques.

IL-28B Interleukin-28B Mouse Recombinant Protein

PROTQ8CGK6 Regular: 20ug
EUR 317
Description: IL-28B Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 174 amino acids and having a molecular mass of 19.6kDa.;The IL28B is purified by proprietary chromatographic techniques.

Mouse pre-microRNA Expression Construct mir-28b

MMIR-28b-PA-1 Bacterial Streak
EUR 684
  • Category: MicroRNA Tools

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3

CS26-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3

CS26-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3

CS26-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3

CS26-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.


EF006145 96 Tests
EUR 689

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)

CA25-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)

CA25-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)

CA25-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)

CA25-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

IL28B Antibody

32947-100ul 100ul
EUR 252

IL28B Antibody

DF8984 200ul
EUR 304
Description: IL28B Antibody detects endogenous levels of total IL28B.

IL28B Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

IL28B Protein

  • EUR 328.00
  • EUR 7023.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

IL28B Antibody

ABD8984 100 ug
EUR 438

pET- 28b

PVT0081 2 ug
EUR 256

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

ELISA kit for Human IL-28B/IFN-lambda3

EK5786 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IL-28B/IFN-lambda3 in samples from serum, plasma, tissue homogenates and other biological fluids.

IL-28B ELISA Kit (Human) : 96 Wells (OKAG00147)

OKAG00147 96 Wells
EUR 596
Description: Description of target: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA).;Species reactivity: Human;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 32 pg/mL

IL28B Blocking Peptide

DF8984-BP 1mg
EUR 195

IL28B Conjugated Antibody

C32947 100ul
EUR 397

IL28B / IFNL3 Antibody

abx234263-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

IL28B cloning plasmid

CSB-CL810313HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 591
  • Sequence: atgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagttcctgtcgccaggctccgcggggctctcccggatgcaaggggctgccacatagcccagttcaagtccctgtctccacaggagctgcaggcctttaagagggccaaagatgc
  • Show more
Description: A cloning plasmid for the IL28B gene.

IL28B Polyclonal Antibody

ABP58926-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180

IL28B Polyclonal Antibody

ABP58926-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180

IL28B Polyclonal Antibody

ABP58926-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180

IL28B Polyclonal Antibody

ES9175-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IL28B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

IL28B Polyclonal Antibody

ES9175-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IL28B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-IL28B antibody

STJ190333 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IL28B

pET- 28b Plasmid

PVT0340 2 ug
EUR 266

Human Interferon Lambda 3 (IL28B) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Coiled-Coil Domain Containing 28B (CCDC28B) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

IL28B ORF Vector (Human) (pORF)

ORF013352 1.0 ug DNA
EUR 354

Human CellExp? IL-28B, Human Recombinant

EUR 343

Human CellExp? IL-28B, Human Recombinant

EUR 1333

Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit

E01C1070-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit

E01C1070-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit

E01C1070-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-IL28B/ IFNL3 antibody

PAab04263 100 ug
EUR 412

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Polyclonal IL-28B Antibody

APR16822G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL-28B . This antibody is tested and proven to work in the following applications:

mmu-miR-28b Primers

MPM02272 150 ul / 10 uM
EUR 121


PVT12290 2 ug
EUR 703

IL28B sgRNA CRISPR Lentivector set (Human)

K1083001 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Il28b ORF Vector (Mouse) (pORF)

ORF047875 1.0 ug DNA
EUR 506

IL28B sgRNA CRISPR Lentivector (Human) (Target 1)

K1083002 1.0 ug DNA
EUR 154

IL28B sgRNA CRISPR Lentivector (Human) (Target 2)

K1083003 1.0 ug DNA
EUR 154

IL28B sgRNA CRISPR Lentivector (Human) (Target 3)

K1083004 1.0 ug DNA
EUR 154

IL28B Protein Vector (Human) (pPB-C-His)

PV053405 500 ng
EUR 481

IL28B Protein Vector (Human) (pPB-N-His)

PV053406 500 ng
EUR 481

IL28B Protein Vector (Human) (pPM-C-HA)

PV053407 500 ng
EUR 481

IL28B Protein Vector (Human) (pPM-C-His)

PV053408 500 ng
EUR 481

Recombinant Human IL28B Protein, His, Insect-10ug

QP12417-10ug 10ug
EUR 201

Recombinant Human IL28B Protein, His, Insect-1mg

QP12417-1mg 1mg
EUR 5251

Recombinant Human IL28B Protein, His, Insect-2ug

QP12417-2ug 2ug
EUR 155

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

mmu-miR-28b miRNA Antagomir

MNM01585 2 x 5.0 nmol
EUR 329

mmu-miR-28b miRNA Inhibitor

MIM01585 2 x 5.0 nmol
EUR 176

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human IL28B(Interleukin 28B) ELISA Kit