Human IL28B(Interleukin 28B) ELISA Kit

Human IL28B(Interleukin 28B) ELISA Kit

Human Interleukin 28B (IL28B) ELISA Kit
RDR-IL28B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 481

Human Interleukin 28B (IL28B) ELISA Kit
RDR-IL28B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 665

Human Interleukin 28B (IL28B) ELISA Kit
RD-IL28B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 460

Human Interleukin 28B (IL28B) ELISA Kit
RD-IL28B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 636

Human Interleukin 28B (IL28B) ELISA Kit
20-abx152037	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 28B (IL28B) ELISA Kit
20-abx258388	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 28B (IL28B) ELISA Kit
abx251386-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human IL28B/ Interleukin-28B ELISA Kit
E2925Hu	Sunlong	1 Kit	EUR 605

Human Interleukin- 28B, IL28B ELISA KIT
ELI-06518h	Lifescience Market	96 Tests	EUR 824

Human Interleukin 28B (IL28B) ELISA Kit
SEC028Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit
SEC028Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit
SEC028Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit
SEC028Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) ELISA Kit
4-SEC028Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3 Interferon, Lambda 3 Cytokine Zcyto22
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 28B (IL28B) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Active Interleukin 28B (IL28B)
4-APC028Hu01	Cloud-Clone	EUR 816.80 EUR 322.00 EUR 2788.00 EUR 996.00 EUR 1892.00 EUR 610.00 EUR 6820.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.6kDa Isoelectric Point: 9
Description: Recombinant Human Interleukin 28B expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Interleukin 28B (IL28B) Antibody
20-abx004319	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Interleukin 28B (IL28B) Antibody
20-abx131937	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-15 working days.

Interleukin 28B (IL28B) Antibody
abx029111-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Interleukin 28B (IL28B) Antibody
abx029111-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mouse Interleukin- 28B, Il28b ELISA KIT
ELI-06519m	Lifescience Market	96 Tests	EUR 865

Human Interleukin 28B (IL28B) CLIA Kit
20-abx490724	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Interleukin 28B (IL28B)CLIA Kit
SCC028Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B)CLIA Kit
SCC028Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B)CLIA Kit
SCC028Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B)CLIA Kit
SCC028Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 28B (IL28B) CLIA Kit
4-SCC028Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 28B Clia kit. Alternative names of the recognized antigen: IFNL3 Interferon, Lambda 3 Cytokine Zcyto22
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 28B (IL28B)serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids

ELISA kit for Human IL28B (Interleukin 28B)
ELK1783	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 28B (IL28B). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleuki Show more
Description: A sandwich ELISA kit for detection of Interleukin 28B from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Interleukin 28B (IL28B) Antibody (Biotin)
20-abx272239	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Interleukin 28B (IL28B) Antibody (FITC)
20-abx273652	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Interleukin 28B (IL28B) Protein (Active)
20-abx655729	Abbexa	EUR 1121.00 EUR 411.00 EUR 3724.00 EUR 1358.00 EUR 759.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 28B (IL28B) Monoclonal Antibody (Human)
4-MAC028Hu22	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B)

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit
HEC028Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit
HEC028Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit
HEC028Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit
HEC028Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of High Sensitive Human Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assa Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 28B (IL28B) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

High Sensitive Human Interleukin 28B (IL28B) ELISA Kit
4-HEC028Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3 Interferon, Lambda 3 Cytokine Zcyto22
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of High Sensitive Human Interleukin 28B (IL28B) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit
MEC028Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5804.88
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit
MEC028Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 565.7
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit
MEC028Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 765.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit
MEC028Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3143.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 28B (IL28B) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 28B (IL28B).

Mini Samples Mouse Interleukin 28B (IL28B) ELISA Kit
4-MEC028Mu	Cloud-Clone	EUR 5855.00 EUR 3094.00 EUR 766.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 28B elisa. Alternative names of the recognized antigen: IFNL3 Interferon, Lambda 3 Cytokine Zcyto22
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 28B (IL28B) in samples from n/a with no significant corss-reactivity with analogues from other species.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), APC
4-MAC028Hu22-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with APC.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), Biotinylated
4-MAC028Hu22-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with Biotin.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), Cy3
4-MAC028Hu22-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with Cy3.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), FITC
4-MAC028Hu22-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with FITC.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), HRP
4-MAC028Hu22-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with HRP.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), PE
4-MAC028Hu22-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with PE.

Recombinant Human IFNL3/IL28B/Interleukin-28B Protein
RP00219	Abclonal	5 μg	EUR 155

IL28B Human, Interleukin 28B Human Recombinant Protein, Sf9
PROTQ8IZI9-1	BosterBio	Regular: 10ug	EUR 317
Description: IL 28B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (22-196 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 181 amino acids and having a molecular mass of 20.4kDa.;IL 28B shows multiple bands between 18-28kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

Interleukin 28B (IL28B) Monoclonal Antibody (Human), APC-Cy7
4-MAC028Hu22-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Interleukin 28B (IL28B). This antibody is labeled with APC-Cy7.

Human Interleukin 28B,IL-28B ELISA Kit
201-12-0042	SunredBio	96 tests	EUR 440
This Interleukin 28B ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human IL-28B(Interleukin-28B) ELISA Kit
EH2057	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: Q8IZI9 Alias: IL28B(Interleukin-28B)/IL-28B/Interleukin-28C/IL-28C/Interferon lambda-4/IFN-lambda-4/Cytokine Zcyto22/Interferon lambda-3/IFN-lambda-3/IL28C/IL-28B/interferon, lambda 3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin 28B(IL-28B) ELISA kit
CSB-E13296h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28B (IL-28B) in samples from serum, plasma, cellculturesupernats, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 28B(IL-28B) ELISA kit
1-CSB-E13296h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 28B(IL-28B) in samples from serum, plasma, cellculturesupernats, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 28B(IL-28B)ELISA Kit
GA-E0089HM-48T	GenAsia Biotech	48T	EUR 289

Human Interleukin 28B(IL-28B)ELISA Kit
GA-E0089HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 28B(IL-28B)ELISA Kit
QY-E04282	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human IL-28B (Interleukin 28B)
E-EL-H5508	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-28B ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-28B. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-28B (Interleukin 28B) in samples from Serum, Plasma, Cell supernatant

Porcine Interleukin 28B, IL- 28B ELISA Kit
ELA-E2028p	Lifescience Market	96 Tests	EUR 928

IL-28B Interleukin-28B Human Recombinant Protein
PROTQ8IZI9	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-28B Human Recombinant produced in HEK cells is a non-glycosylated monomer, having a total molecular weight of 24kDa.;The IL28B is purified by proprietary chromatographic techniques.

IL-28B Interleukin-28B Mouse Recombinant Protein
PROTQ8CGK6	BosterBio	Regular: 20ug	EUR 317
Description: IL-28B Mouse Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 174 amino acids and having a molecular mass of 19.6kDa.;The IL28B is purified by proprietary chromatographic techniques.

Mouse pre-microRNA Expression Construct mir-28b
MMIR-28b-PA-1	SBI	Bacterial Streak	EUR 684
Category: MicroRNA Tools

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3
CS26-10ug	Novoprotein	10ug	EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3
CS26-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3
CS26-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3
CS26-50ug	Novoprotein	50ug	EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

IL28B ELISA KIT\|Human
EF006145	Lifescience Market	96 Tests	EUR 689

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)
CA25-10ug	Novoprotein	10ug	EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)
CA25-1mg	Novoprotein	1mg	EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)
CA25-500ug	Novoprotein	500ug	EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

Recombinant Human Interleukin-28B/IL-28B/IFN-lambda 3 (C-6His)
CA25-50ug	Novoprotein	50ug	EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM EDTA,pH7.4.

IL28B Antibody
32947-100ul	SAB	100ul	EUR 252

IL28B Antibody
DF8984	Affbiotech	200ul	EUR 304
Description: IL28B Antibody detects endogenous levels of total IL28B.

IL28B Protein
20-abx261676	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

IL28B Protein
20-abx263021	Abbexa	EUR 328.00 EUR 7023.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

IL28B Antibody
ABD8984	Lifescience Market	100 ug	EUR 438

pET- 28b
PVT0081	Lifescience Market	2 ug	EUR 256

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

ELISA kit for Human IL-28B/IFN-lambda3
EK5786	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human IL-28B/IFN-lambda3 in samples from serum, plasma, tissue homogenates and other biological fluids.

IL-28B ELISA Kit (Human) : 96 Wells (OKAG00147)
OKAG00147	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 29 (IL29) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA).;Species reactivity: Human;Application: ELISA;Assay info: Quantitative Colorimentric Sandwich ELISA;Sensitivity: 32 pg/mL

IL28B Blocking Peptide
DF8984-BP	Affbiotech	1mg	EUR 195

IL28B Conjugated Antibody
C32947	SAB	100ul	EUR 397

IL28B / IFNL3 Antibody
abx234263-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

IL28B cloning plasmid
CSB-CL810313HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 591 Sequence: atgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagttcctgtcgccaggctccgcggggctctcccggatgcaaggggctgccacatagcccagttcaagtccctgtctccacaggagctgcaggcctttaagagggccaaagatgc Show more
Description: A cloning plasmid for the IL28B gene.

IL28B Polyclonal Antibody
ABP58926-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180 Applications tips:
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180

IL28B Polyclonal Antibody
ABP58926-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180 Applications tips:
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180

IL28B Polyclonal Antibody
ABP58926-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180 Applications tips:
Description: A polyclonal antibody for detection of IL28B from Human, Mouse. This IL28B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IL28B protein at amino acid sequence of 100-180

IL28B Polyclonal Antibody
ES9175-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IL28B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

IL28B Polyclonal Antibody
ES9175-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IL28B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-IL28B antibody
STJ190333	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to IL28B

pET- 28b Plasmid
PVT0340	Lifescience Market	2 ug	EUR 266

Human Interferon Lambda 3 (IL28B) CLIA Kit
20-abx190279	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Coiled-Coil Domain Containing 28B (CCDC28B) ELISA Kit
20-abx386339	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

IL28B ORF Vector (Human) (pORF)
ORF013352	ABM	1.0 ug DNA	EUR 354

Human CellExp? IL-28B, Human Recombinant
6472-10	Biovision		EUR 343

Human CellExp? IL-28B, Human Recombinant
6472-50	Biovision		EUR 1333

Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit
E01C1070-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 28B(CCDC28B) ELISA kit
E01C1070-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 28B(CCDC28B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human IL28B(Interleukin 28B) ELISA Kit