Human IL29(Interleukin 29) ELISA Kit
Human Interleukin 29 (IL29) ELISA Kit |
RD-IL29-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 636 |
Human Interleukin 29 (IL29) ELISA Kit |
RDR-IL29-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 481 |
Human Interleukin 29 (IL29) ELISA Kit |
RDR-IL29-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 665 |
Human Interleukin-29 (IL29) |
1-CSB-EP811596HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 36 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Interleukin-29(IL29),partial expressed in E.coli |
Human IL29/ Interleukin-29 ELISA Kit |
E2926Hu |
Sunlong |
1 Kit |
EUR 605 |
Human Interleukin 29 (IL29) ELISA Kit |
20-abx152038 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Interleukin 29 (IL29) ELISA Kit |
abx251271-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Interleukin 29 (IL29) ELISA Kit |
SEC029Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 29 (IL29) ELISA Kit |
SEC029Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 29 (IL29) ELISA Kit |
SEC029Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 29 (IL29) ELISA Kit |
SEC029Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Interleukin 29 (IL29) ELISA Kit |
4-SEC029Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Interleukin 29 elisa. Alternative names of the recognized antigen: FNL1
- Interferon, Lambda 1
- Cytokine Zcyto21
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 29 (IL29) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Active Interleukin 29 (IL29) |
4-APC029Hu01 |
Cloud-Clone |
-
EUR 841.89
-
EUR 328.00
-
EUR 2882.08
-
EUR 1027.36
-
EUR 1954.72
-
EUR 626.00
-
EUR 7055.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8IU54
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.7kDa
- Isoelectric Point: 9.3
|
Description: Recombinant Human Interleukin 29 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells |
Interleukin 29 (IL29) Antibody |
20-abx128828 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Interleukin 29 (IL29) Antibody |
abx037231-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Interleukin 29 (IL29) Antibody |
20-abx173150 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Recombinant Interleukin 29 (IL29) |
4-RPC029Hu01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8IU54
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 23.8kDa
- Isoelectric Point: 9.3
|
Description: Recombinant Human Interleukin 29 expressed in: E.coli |
Human Interleukin 29 (IL29) Protein |
20-abx167129 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Human IL29 (Interleukin 29) |
ELK1784 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 29 (IL29). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin
- Show more
|
Description: A sandwich ELISA kit for detection of Interleukin 29 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Interleukin 29 (IL29)CLIA Kit |
SCC029Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5647.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids. |
Human Interleukin 29 (IL29)CLIA Kit |
SCC029Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 552.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids. |
Human Interleukin 29 (IL29)CLIA Kit |
SCC029Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 746.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids. |
Human Interleukin 29 (IL29)CLIA Kit |
SCC029Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3060.6 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids. |
Human Interleukin 29 (IL29) CLIA Kit |
4-SCC029Hu |
Cloud-Clone |
-
EUR 5698.00
-
EUR 3061.00
-
EUR 747.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Interleukin 29 Clia kit. Alternative names of the recognized antigen: FNL1
- Interferon, Lambda 1
- Cytokine Zcyto21
|
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29)Serum, plasma and other biological fluids |
Human Interleukin 29 (IL29) Protein (Active) |
20-abx655730 |
Abbexa |
-
EUR 1149.00
-
EUR 411.00
-
EUR 3850.00
-
EUR 1400.00
-
EUR 787.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Interleukin 29 (IL29) Polyclonal Antibody (Human) |
4-PAC029Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29) |
Interleukin 29 (IL29) Monoclonal Antibody (Human) |
4-MAC029Hu22 |
Cloud-Clone |
-
EUR 255.00
-
EUR 2642.00
-
EUR 655.00
-
EUR 322.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29) |
Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit |
MEC029Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5804.88 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29). |
Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit |
MEC029Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 565.7 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29). |
Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit |
MEC029Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 765.28 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29). |
Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit |
MEC029Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 3143.76 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29). |
Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit |
4-MEC029Mu |
Cloud-Clone |
-
EUR 5855.00
-
EUR 3094.00
-
EUR 766.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Interleukin 29 elisa. Alternative names of the recognized antigen: FNL1
- Interferon, Lambda 1
- Cytokine Zcyto21
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 29 (IL29) in samples from n/a with no significant corss-reactivity with analogues from other species. |
Interleukin 29 (IL29) Polyclonal Antibody (Human), APC |
4-PAC029Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC. |
Interleukin 29 (IL29) Polyclonal Antibody (Human), Biotinylated |
4-PAC029Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Biotin. |
Interleukin 29 (IL29) Polyclonal Antibody (Human), Cy3 |
4-PAC029Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Cy3. |
Interleukin 29 (IL29) Polyclonal Antibody (Human), FITC |
4-PAC029Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with FITC. |
Interleukin 29 (IL29) Polyclonal Antibody (Human), HRP |
4-PAC029Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with HRP. |
Interleukin 29 (IL29) Polyclonal Antibody (Human), PE |
4-PAC029Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with PE. |
Interleukin 29 (IL29) Monoclonal Antibody (Human), APC |
4-MAC029Hu22-APC |
Cloud-Clone |
-
EUR 358.00
-
EUR 3455.00
-
EUR 957.00
-
EUR 458.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC. |
Interleukin 29 (IL29) Monoclonal Antibody (Human), Biotinylated |
4-MAC029Hu22-Biotin |
Cloud-Clone |
-
EUR 320.00
-
EUR 2592.00
-
EUR 760.00
-
EUR 394.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Biotin. |
Interleukin 29 (IL29) Monoclonal Antibody (Human), Cy3 |
4-MAC029Hu22-Cy3 |
Cloud-Clone |
-
EUR 435.00
-
EUR 4565.00
-
EUR 1235.00
-
EUR 569.00
-
EUR 258.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Cy3. |
Interleukin 29 (IL29) Monoclonal Antibody (Human), FITC |
4-MAC029Hu22-FITC |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with FITC. |
Interleukin 29 (IL29) Monoclonal Antibody (Human), HRP |
4-MAC029Hu22-HRP |
Cloud-Clone |
-
EUR 327.00
-
EUR 3011.00
-
EUR 846.00
-
EUR 413.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with HRP. |
Interleukin 29 (IL29) Monoclonal Antibody (Human), PE |
4-MAC029Hu22-PE |
Cloud-Clone |
-
EUR 306.00
-
EUR 2784.00
-
EUR 786.00
-
EUR 386.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with PE. |
Interleukin 29 (IL29) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC029Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IL29 (Gly20~Thr200)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC-Cy7. |
Interleukin 29 (IL29) Monoclonal Antibody (Human), APC-Cy7 |
4-MAC029Hu22-APC-Cy7 |
Cloud-Clone |
-
EUR 596.00
-
EUR 6790.00
-
EUR 1795.00
-
EUR 796.00
-
EUR 329.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly20~Thr200
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC-Cy7. |
Human IL-29(Interleukin 29) ELISA Kit |
EH0195 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 15.625-1000 pg/ml
- Uniprot ID: Q8IU54
- Alias: IL-29
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml |
Human Interleukin 29(IL-29)ELISA Kit |
GA-E0088HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Interleukin 29(IL-29)ELISA Kit |
GA-E0088HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
Human Interleukin 29,IL-29 ELISA Kit |
201-12-0041 |
SunredBio |
96 tests |
EUR 440 |
- This Interleukin 29 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Interleukin 29(IL-29)ELISA Kit |
CSB-E14290h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 29 (IL-29) in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Interleukin 29(IL-29)ELISA Kit |
1-CSB-E14290h |
Cusabio |
-
EUR 703.00
-
EUR 4843.00
-
EUR 2570.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 29(IL-29) in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Interleukin 29 ELISA kit |
E01I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interleukin 29 ELISA kit |
E01I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interleukin 29 ELISA kit |
E01I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ELISA kit for Human IL-29 (Interleukin 29) |
E-EL-H5509 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's IL-29 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-29. Standards or samples are added to the micro ELISA plate wells and combined with
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human IL-29 (Interleukin 29) in samples from Serum, Plasma, Cell supernatant |
Mouse Interleukin 29(IL-29) ELISA Kit |
CSB-E17652m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 29 (IL-29) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Interleukin 29(IL-29) ELISA Kit |
1-CSB-E17652m |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 29(IL-29) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Goat Interleukin 29 ELISA kit |
E06I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Interleukin 29 ELISA kit |
E06I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Interleukin 29 ELISA kit |
E06I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Interleukin 29 ELISA kit |
E02I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Interleukin 29 ELISA kit |
E02I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Interleukin 29 ELISA kit |
E02I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interleukin 29 ELISA kit |
E03I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interleukin 29 ELISA kit |
E03I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Interleukin 29 ELISA kit |
E03I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interleukin 29 ELISA kit |
E04I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interleukin 29 ELISA kit |
E04I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Interleukin 29 ELISA kit |
E04I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Interleukin 29 ELISA kit |
E08I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Interleukin 29 ELISA kit |
E08I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Interleukin 29 ELISA kit |
E08I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Interleukin 29 ELISA kit |
E07I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Interleukin 29 ELISA kit |
E07I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Interleukin 29 ELISA kit |
E07I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Interleukin 29 ELISA kit |
E09I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Interleukin 29 ELISA kit |
E09I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Interleukin 29 ELISA kit |
E09I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Interleukin-29 (IL-29) Antibody |
35625-05111 |
AssayPro |
150 ug |
EUR 261 |
Interleukin-29 (IL-29) Antibody |
abx234264-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Interleukin-29 (IL-29) Antibody |
abx234265-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Recombinant Human Interleukin-29 |
7-01093 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Interleukin-29 |
7-01094 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Interleukin-29 |
7-01095 |
CHI Scientific |
1mg |
Ask for price |
Guinea pig Interleukin 29 ELISA kit |
E05I0029-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Interleukin 29 ELISA kit |
E05I0029-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Interleukin 29 ELISA kit |
E05I0029-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
IL-29 Interleukin-29 Human Recombinant Protein |
PROTQ8IU54-1 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: IL-29 human recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 181 amino acids and having a molecular mass of 20 kDa. |
IL29 ELISA Kit (Human) (OKCD07924) |
OKCD07924 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Recombinant Human Interleukin-29;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.7pg/mL |
Human Interleukin-29 (IL-29) Antibody (Biotin Conjugate) |
35625-05121 |
AssayPro |
150 ug |
EUR 369 |
IL-29 Interleukin-29 Human Recombinant Protein, HEK |
PROTQ8IU54 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: IL-29 Human Recombinant produced in HEK cells is a glycosylated monomer, having a molecular weight range of 29-35kDa due to glycosylation.;The IL-29 is purified by proprietary chromatographic techniques. |
IL-29 Interleukin-29 Human Recombinant Protein, Sf9 |
PROTQ8IU54-3 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-29 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 187 amino acids (20-200a.a.) and having a molecular mass of 20.8kDa (Molecular size on SDS-PAGE will appear at approximately 18-28kDa).;IL29 is fused with a 6 amino acids His tag at C-Terminus and purified by proprietary chromatographic techniques. |
CMV (Cytomegalovirus Antibody IgM) ELISA test |
29 |
Biobase |
96T/Box |
Ask for price |
- Area of application: Prepotency testing
|
Description: ELISA based test for quantitative detection of CMV (Cytomegalovirus Antibody IgM) |
Interleukin-29 Polyclonal Antibody |
42566-100ul |
SAB |
100ul |
EUR 333 |
Human Interleukin-29 (IL-29) AssayLite Antibody (FITC Conjugate) |
35625-05141 |
AssayPro |
150 ug |
EUR 428 |
Human Interleukin-29 (IL-29) AssayLite Antibody (RPE Conjugate) |
35625-05151 |
AssayPro |
150 ug |
EUR 428 |
Human Interleukin-29 (IL-29) AssayLite Antibody (APC Conjugate) |
35625-05161 |
AssayPro |
150 ug |
EUR 428 |
Human Interleukin-29 (IL-29) AssayLite Antibody (PerCP Conjugate) |
35625-05171 |
AssayPro |
150 ug |
EUR 471 |
IL-29 Interleukin-29 Human Recombinant Protein, His Tag |
PROTQ8IU54-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: IL 29 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids (20-200 a.a) and having a molecular mass of 22.7kDa.IL 29 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-100ug |
QP10410-ec-100ug |
EnQuireBio |
100ug |
EUR 988 |
Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-20ug |
QP10410-ec-20ug |
EnQuireBio |
20ug |
EUR 290 |
Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-250ug |
QP10410-ec-250ug |
EnQuireBio |
250ug |
EUR 1731 |
Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-5ug |
QP10410-ec-5ug |
EnQuireBio |
5ug |
EUR 154 |
Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-1mg |
QP5293-1mg |
EnQuireBio |
1mg |
EUR 2856 |
Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-500ug |
QP5293-500ug |
EnQuireBio |
500ug |
EUR 1778 |
IL29 Antibody |
39572-100ul |
SAB |
100ul |
EUR 390 |
IL29 protein |
30R-2797 |
Fitzgerald |
20 ug |
EUR 359 |
Description: Purified recombinant Human IL29 protein |
Interleukin-29 Polyclonal Conjugated Antibody |
C42566 |
SAB |
100ul |
EUR 397 |
Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-100ug |
QP7814-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-10ug |
QP7814-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-1mg |
QP7814-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-200ug |
QP7814-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-500ug |
QP7814-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-50ug |
QP7814-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human IL-29 ELISA kit |
CT525A |
U-CyTech |
5-plate |
EUR 462 |
Human IL-29 ELISA Kit |
LF-EK50983 |
Abfrontier |
1×96T |
EUR 648 |
Anti-IL29 Antibody |
A30780 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal IL29 Antibody. Validated in WB and tested in Human. |
IL29 cloning plasmid |
CSB-CL811596HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 603
- Sequence: atggctgcagcttggaccgtggtgctggtgactttggtgctaggcttggccgtggcaggccctgtccccacttccaagcccaccacaactgggaagggctgccacattggcaggttcaaatctctgtcaccacaggagctagcgagcttcaagaaggccagggacgccttggaaga
- Show more
|
Description: A cloning plasmid for the IL29 gene. |
IL29 cloning plasmid |
CSB-CL811596HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 603
- Sequence: atggctgcagcttggaccgtggtgctggtgactttggtgctaggcttggccgtggcaggccctgtccccacttccaagcccaccacaactgggaagggctgccacattggcaggttcaaatctctgtcaccacaggagctagcgagcttcaagaaggccagggacgccttggaaga
- Show more
|
Description: A cloning plasmid for the IL29 gene. |
Human cancer antigen 27-29 (CA 27-29) ELISA Kit |
CSB-E13858h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human cancer antigen 27-29 (CA 27-29) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human cancer antigen 27-29 (CA 27-29) ELISA Kit |
1-CSB-E13858h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human cancer antigen 27-29 (CA 27-29) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Interferon Lambda 1 (IL29) CLIA Kit |
20-abx190315 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
IL29 ORF Vector (Human) (pORF) |
ORF013353 |
ABM |
1.0 ug DNA |
EUR 354 |
IL29 ORF Vector (Human) (pORF) |
ORF013354 |
ABM |
1.0 ug DNA |
EUR 354 |
Human IL29(Interleukin 29) ELISA Kit