Human IL29(Interleukin 29) ELISA Kit

Human IL29(Interleukin 29) ELISA Kit

Human Interleukin 29 (IL29) ELISA Kit
RD-IL29-Hu-96Tests	Reddot Biotech	96 Tests	EUR 636

Human Interleukin 29 (IL29) ELISA Kit
RDR-IL29-Hu-48Tests	Reddot Biotech	48 Tests	EUR 481

Human Interleukin 29 (IL29) ELISA Kit
RDR-IL29-Hu-96Tests	Reddot Biotech	96 Tests	EUR 665

Human Interleukin-29 (IL29)
1-CSB-EP811596HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 36 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin-29(IL29),partial expressed in E.coli

Human IL29/ Interleukin-29 ELISA Kit
E2926Hu	Sunlong	1 Kit	EUR 605

Human Interleukin- 29, IL29 ELISA KIT
ELI-06520h	Lifescience Market	96 Tests	EUR 824

Human Interleukin 29 (IL29) ELISA Kit
20-abx152038	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Interleukin 29 (IL29) ELISA Kit
abx251271-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Interleukin 29 (IL29) ELISA Kit
SEC029Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 29 (IL29) ELISA Kit
SEC029Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 29 (IL29) ELISA Kit
SEC029Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 29 (IL29) ELISA Kit
SEC029Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 29 (IL29) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Interleukin 29 (IL29) ELISA Kit
4-SEC029Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 29 elisa. Alternative names of the recognized antigen: FNL1 Interferon, Lambda 1 Cytokine Zcyto21
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 29 (IL29) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Active Interleukin 29 (IL29)
4-APC029Hu01	Cloud-Clone	EUR 841.89 EUR 328.00 EUR 2882.08 EUR 1027.36 EUR 1954.72 EUR 626.00 EUR 7055.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8IU54 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.7kDa Isoelectric Point: 9.3
Description: Recombinant Human Interleukin 29 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Interleukin 29 (IL29) Antibody
20-abx128828	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 29 (IL29) Antibody
abx037231-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Interleukin 29 (IL29) Antibody
20-abx173150	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Recombinant Interleukin 29 (IL29)
4-RPC029Hu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8IU54 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 23.8kDa Isoelectric Point: 9.3
Description: Recombinant Human Interleukin 29 expressed in: E.coli

Human Interleukin 29 (IL29) Protein
20-abx167129	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Human IL29 (Interleukin 29)
ELK1784	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Interleukin 29 (IL29). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Interleukin Show more
Description: A sandwich ELISA kit for detection of Interleukin 29 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Interleukin 29 (IL29)CLIA Kit
SCC029Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5647.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids.

Human Interleukin 29 (IL29)CLIA Kit
SCC029Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 552.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids.

Human Interleukin 29 (IL29)CLIA Kit
SCC029Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 746.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids.

Human Interleukin 29 (IL29)CLIA Kit
SCC029Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3060.6
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29) in serum, plasma and other biological fluids.

Human Interleukin 29 (IL29) CLIA Kit
4-SCC029Hu	Cloud-Clone	EUR 5698.00 EUR 3061.00 EUR 747.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 29 Clia kit. Alternative names of the recognized antigen: FNL1 Interferon, Lambda 1 Cytokine Zcyto21
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Interleukin 29 (IL29)Serum, plasma and other biological fluids

Human Interleukin 29 (IL29) Protein (Active)
20-abx655730	Abbexa	EUR 1149.00 EUR 411.00 EUR 3850.00 EUR 1400.00 EUR 787.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Interleukin 29 (IL29) Polyclonal Antibody (Human)
4-PAC029Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29)

Interleukin 29 (IL29) Monoclonal Antibody (Human)
4-MAC029Hu22	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29)

Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit
MEC029Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5804.88
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29).

Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit
MEC029Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 565.7
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29).

Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit
MEC029Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 765.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29).

Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit
MEC029Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 3143.76
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mini Samples Mouse Interleukin 29 (IL29) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: C Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mini Samples Mouse Interleukin 29 (IL29).

Mini Samples Mouse Interleukin 29 (IL29) ELISA Kit
4-MEC029Mu	Cloud-Clone	EUR 5855.00 EUR 3094.00 EUR 766.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Interleukin 29 elisa. Alternative names of the recognized antigen: FNL1 Interferon, Lambda 1 Cytokine Zcyto21
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mini Samples Mouse Interleukin 29 (IL29) in samples from n/a with no significant corss-reactivity with analogues from other species.

Interleukin 29 (IL29) Polyclonal Antibody (Human), APC
4-PAC029Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC.

Interleukin 29 (IL29) Polyclonal Antibody (Human), Biotinylated
4-PAC029Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Biotin.

Interleukin 29 (IL29) Polyclonal Antibody (Human), Cy3
4-PAC029Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Cy3.

Interleukin 29 (IL29) Polyclonal Antibody (Human), FITC
4-PAC029Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with FITC.

Interleukin 29 (IL29) Polyclonal Antibody (Human), HRP
4-PAC029Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with HRP.

Interleukin 29 (IL29) Polyclonal Antibody (Human), PE
4-PAC029Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with PE.

Interleukin 29 (IL29) Monoclonal Antibody (Human), APC
4-MAC029Hu22-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC.

Interleukin 29 (IL29) Monoclonal Antibody (Human), Biotinylated
4-MAC029Hu22-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Biotin.

Interleukin 29 (IL29) Monoclonal Antibody (Human), Cy3
4-MAC029Hu22-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with Cy3.

Interleukin 29 (IL29) Monoclonal Antibody (Human), FITC
4-MAC029Hu22-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with FITC.

Interleukin 29 (IL29) Monoclonal Antibody (Human), HRP
4-MAC029Hu22-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with HRP.

Interleukin 29 (IL29) Monoclonal Antibody (Human), PE
4-MAC029Hu22-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with PE.

Interleukin 29 (IL29) Polyclonal Antibody (Human), APC-Cy7
4-PAC029Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: IL29 (Gly20~Thr200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC-Cy7.

Interleukin 29 (IL29) Monoclonal Antibody (Human), APC-Cy7
4-MAC029Hu22-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly20~Thr200 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Interleukin 29 (IL29). This antibody is labeled with APC-Cy7.

Human IL-29(Interleukin 29) ELISA Kit
EH0195	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: Q8IU54 Alias: IL-29
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin 29(IL-29)ELISA Kit
GA-E0088HM-48T	GenAsia Biotech	48T	EUR 289

Human Interleukin 29(IL-29)ELISA Kit
GA-E0088HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 29,IL-29 ELISA Kit
201-12-0041	SunredBio	96 tests	EUR 440
This Interleukin 29 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 29(IL-29)ELISA Kit
CSB-E14290h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 29 (IL-29) in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 29(IL-29)ELISA Kit
1-CSB-E14290h	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 29(IL-29) in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 29(IL-29)ELISA Kit
QY-E04280	Qayee Biotechnology	96T	EUR 361

Human Interleukin 29 ELISA kit
E01I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 29 ELISA kit
E01I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 29 ELISA kit
E01I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human IL-29 (Interleukin 29)
E-EL-H5509	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-29 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-29. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-29 (Interleukin 29) in samples from Serum, Plasma, Cell supernatant

Mouse Interleukin 29(IL-29) ELISA Kit
CSB-E17652m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 29 (IL-29) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin 29(IL-29) ELISA Kit
1-CSB-E17652m	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 29(IL-29) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Goat Interleukin 29 ELISA kit
E06I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 29 ELISA kit
E06I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Interleukin 29 ELISA kit
E06I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 29 ELISA kit
E02I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 29 ELISA kit
E02I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Interleukin 29 ELISA kit
E02I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 29 ELISA kit
E03I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 29 ELISA kit
E03I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Interleukin 29 ELISA kit
E03I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 29 ELISA kit
E04I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 29 ELISA kit
E04I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Interleukin 29 ELISA kit
E04I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 29 ELISA kit
E08I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 29 ELISA kit
E08I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Interleukin 29 ELISA kit
E08I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 29 ELISA kit
E07I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 29 ELISA kit
E07I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Interleukin 29 ELISA kit
E07I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 29 ELISA kit
E09I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 29 ELISA kit
E09I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Interleukin 29 ELISA kit
E09I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin-29 (IL-29) Antibody
35625-05111	AssayPro	150 ug	EUR 261

Interleukin-29 (IL-29) Antibody
abx234264-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Interleukin-29 (IL-29) Antibody
abx234265-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Recombinant Human Interleukin-29
7-01093	CHI Scientific	5µg	Ask for price

Recombinant Human Interleukin-29
7-01094	CHI Scientific	20µg	Ask for price

Recombinant Human Interleukin-29
7-01095	CHI Scientific	1mg	Ask for price

Guinea pig Interleukin 29 ELISA kit
E05I0029-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 29 ELISA kit
E05I0029-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Interleukin 29 ELISA kit
E05I0029-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Interleukin 29 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

IL-29 Interleukin-29 Human Recombinant Protein
PROTQ8IU54-1	BosterBio	Regular: 20ug	EUR 317
Description: IL-29 human recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 181 amino acids and having a molecular mass of 20 kDa.

IL29 ELISA Kit (Human) (OKCD07924)
OKCD07924	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Recombinant Human Interleukin-29;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.7pg/mL

Human Interleukin-29 (IL-29) Antibody (Biotin Conjugate)
35625-05121	AssayPro	150 ug	EUR 369

IL-29 Interleukin-29 Human Recombinant Protein, HEK
PROTQ8IU54	BosterBio	Regular: 10ug	EUR 317
Description: IL-29 Human Recombinant produced in HEK cells is a glycosylated monomer, having a molecular weight range of 29-35kDa due to glycosylation.;The IL-29 is purified by proprietary chromatographic techniques.

IL-29 Interleukin-29 Human Recombinant Protein, Sf9
PROTQ8IU54-3	BosterBio	Regular: 10ug	EUR 317
Description: Interleukin-29 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 187 amino acids (20-200a.a.) and having a molecular mass of 20.8kDa (Molecular size on SDS-PAGE will appear at approximately 18-28kDa).;IL29 is fused with a 6 amino acids His tag at C-Terminus and purified by proprietary chromatographic techniques.

CMV (Cytomegalovirus Antibody IgM) ELISA test
29	Biobase	96T/Box	Ask for price
Area of application: Prepotency testing
Description: ELISA based test for quantitative detection of CMV (Cytomegalovirus Antibody IgM)

Interleukin-29 Polyclonal Antibody
42566-100ul	SAB	100ul	EUR 333

Human Interleukin-29 (IL-29) AssayLite Antibody (FITC Conjugate)
35625-05141	AssayPro	150 ug	EUR 428

Human Interleukin-29 (IL-29) AssayLite Antibody (RPE Conjugate)
35625-05151	AssayPro	150 ug	EUR 428

Human Interleukin-29 (IL-29) AssayLite Antibody (APC Conjugate)
35625-05161	AssayPro	150 ug	EUR 428

Human Interleukin-29 (IL-29) AssayLite Antibody (PerCP Conjugate)
35625-05171	AssayPro	150 ug	EUR 471

IL-29 Interleukin-29 Human Recombinant Protein, His Tag
PROTQ8IU54-2	BosterBio	Regular: 20ug	EUR 317
Description: IL 29 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 206 amino acids (20-200 a.a) and having a molecular mass of 22.7kDa.IL 29 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-100ug
QP10410-ec-100ug	EnQuireBio	100ug	EUR 988

Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-20ug
QP10410-ec-20ug	EnQuireBio	20ug	EUR 290

Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-250ug
QP10410-ec-250ug	EnQuireBio	250ug	EUR 1731

Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-5ug
QP10410-ec-5ug	EnQuireBio	5ug	EUR 154

Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-1mg
QP5293-1mg	EnQuireBio	1mg	EUR 2856

Recombinant Human IL-29/ Interleukin-29 Protein, Untagged, E.coli-500ug
QP5293-500ug	EnQuireBio	500ug	EUR 1778

IL29 Antibody
39572-100ul	SAB	100ul	EUR 390

IL29 protein
30R-2797	Fitzgerald	20 ug	EUR 359
Description: Purified recombinant Human IL29 protein

Interleukin-29 Polyclonal Conjugated Antibody
C42566	SAB	100ul	EUR 397

Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-100ug
QP7814-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-10ug
QP7814-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-1mg
QP7814-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-200ug
QP7814-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-500ug
QP7814-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human IL-29/ Interleukin-29 Protein, His-SUMO, E.coli-50ug
QP7814-ec-50ug	EnQuireBio	50ug	EUR 263

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

IL-29 ELISA KIT|Human
EF000159	Lifescience Market	96 Tests	EUR 689

Human IL-29 ELISA kit
CT525A	U-CyTech	5-plate	EUR 462

Human IL-29 ELISA Kit
LF-EK50983	Abfrontier	1×96T	EUR 648

Anti-IL29 Antibody
A30780	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal IL29 Antibody. Validated in WB and tested in Human.

IL29 cloning plasmid
CSB-CL811596HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 603 Sequence: atggctgcagcttggaccgtggtgctggtgactttggtgctaggcttggccgtggcaggccctgtccccacttccaagcccaccacaactgggaagggctgccacattggcaggttcaaatctctgtcaccacaggagctagcgagcttcaagaaggccagggacgccttggaaga Show more
Description: A cloning plasmid for the IL29 gene.

IL29 cloning plasmid
CSB-CL811596HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 603 Sequence: atggctgcagcttggaccgtggtgctggtgactttggtgctaggcttggccgtggcaggccctgtccccacttccaagcccaccacaactgggaagggctgccacattggcaggttcaaatctctgtcaccacaggagctagcgagcttcaagaaggccagggacgccttggaaga Show more
Description: A cloning plasmid for the IL29 gene.

Human cancer antigen 27-29 (CA 27-29) ELISA Kit
CSB-E13858h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cancer antigen 27-29 (CA 27-29) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human cancer antigen 27-29 (CA 27-29) ELISA Kit
1-CSB-E13858h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human cancer antigen 27-29 (CA 27-29) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interferon Lambda 1 (IL29) CLIA Kit
20-abx190315	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

IL29 ORF Vector (Human) (pORF)
ORF013353	ABM	1.0 ug DNA	EUR 354

IL29 ORF Vector (Human) (pORF)
ORF013354	ABM	1.0 ug DNA	EUR 354

Human IL29(Interleukin 29) ELISA Kit