Human ITLN1(Intelectin 1) ELISA Kit

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-48Tests 48 Tests
EUR 500

Human Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Hu-96Tests 96 Tests
EUR 692

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-48Tests 48 Tests
EUR 478

Human Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Hu-96Tests 96 Tests
EUR 662

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-48T 48T
EUR 489
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Mu-96T 96T
EUR 635
  • Should the Mouse Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-48T 48T
EUR 508
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

DLR-ITLN1-Ra-96T 96T
EUR 661
  • Should the Rat Intelectin 1 (ITLN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Intelectin 1 (ITLN1) in samples from serum, plasma or other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-48Tests 48 Tests
EUR 511

Mouse Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Mu-96Tests 96 Tests
EUR 709

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-48Tests 48 Tests
EUR 534

Rat Intelectin 1 (ITLN1) ELISA Kit

RDR-ITLN1-Ra-96Tests 96 Tests
EUR 742

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-48Tests 48 Tests
EUR 489

Mouse Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Mu-96Tests 96 Tests
EUR 677

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-48Tests 48 Tests
EUR 511

Rat Intelectin 1 (ITLN1) ELISA Kit

RD-ITLN1-Ra-96Tests 96 Tests
EUR 709

Human Intelectin 1 (ITLN1)ELISA Kit

201-12-2754 96 tests
EUR 440
  • This Intelectin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 1 (ITLN1) ELISA Kit

abx253532-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ITLN1/ Intelectin-1 ELISA Kit

E1354Hu 1 Kit
EUR 537

Human ITLN1(Intelectin-1 ) ELISA Kit

EH0564 96T
EUR 524.1
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: Q8WWA0
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor/omentin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human Intelectin- 1, ITLN1 ELISA KIT

ELI-03070h 96 Tests
EUR 824

Human Intelectin 1(ITLN1)ELISA Kit

QY-E02127 96T
EUR 361

Human Intelectin 1 ELISA Kit (ITLN1)

RK01714 96 Tests
EUR 521

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

SEA933Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 1 (ITLN1) in serum, plasma, tissue homogenates and other biological fluids.

Human Intelectin 1 (ITLN1) ELISA Kit

  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 1 (ITLN1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Intelectin 1 (ITLN1) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin 1 (ITLN1) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-10x96wellstestplate 10x96-wells test plate
EUR 4391.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-1x48wellstestplate 1x48-wells test plate
EUR 449.27
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-1x96wellstestplate 1x96-wells test plate
EUR 598.96
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

SEA933Mu-5x96wellstestplate 5x96-wells test plate
EUR 2395.32
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Mouse Intelectin 1 (ITLN1) ELISA Kit

  • EUR 4442.00
  • EUR 2346.00
  • EUR 599.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

SEA933Ra-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Intelectin 1 (ITLN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Intelectin 1 (ITLN1) in serum, plasma and other biological fluids.

Rat Intelectin 1 (ITLN1) ELISA Kit

  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 1 elisa. Alternative names of the recognized antigen: HL1
  • INTL
  • ITLN
  • LFR
  • HIntL
  • Omentin
  • Intelectin 1, Galactofuranose Binding
  • Intestinal Lactoferrin Receptor
  • Endothelial lectin HL-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Intelectin 1 (ITLN1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Intelectin 1 ELISA Kit (ITLN1)

RK02963 96 Tests
EUR 521

Intelectin 1 (ITLN1) Antibody

  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Intelectin 1 (ITLN1) Antibody

  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Intelectin 1 (ITLN1)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WWA0
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: 7.2
Description: Recombinant Human Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88310
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: 8.8
Description: Recombinant Mouse Intelectin 1 expressed in: E.coli

Recombinant Intelectin 1 (ITLN1)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q499T8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Intelectin 1 expressed in: E.coli

Human Intelectin 1/Omentin (ITLN1) ELISA Kit

abx055557-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Human ITLN1 (Intelectin 1)

ELK2003 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Intelectin 1/Omentin (ITLN1) ELISA Kit

abx574465-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Intelectin 1 (ITLN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Intelectin 1 (ITLN1) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Intelectin 1/Omentin (ITLN1) ELISA Kit

abx254237-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

abx255780-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

ELISA kit for Mouse ITLN1 (Intelectin 1)

ELK2004 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat ITLN1 (Intelectin 1)

ELK2005 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 1 (ITLN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 1
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Monkey Intelectin 1/Omentin (ITLN1) ELISA Kit

abx359483-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Intelectin 1/Omentin (ITLN1) ELISA Kit

abx361255-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Intelectin 1/Omentin (ITLN1) ELISA Kit

abx362579-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Intelectin 1/Omentin (ITLN1) ELISA Kit

abx356771-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) ELISA Kit

abx576145-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Mouse ITLN1(Intelectin 1/Omentin) ELISA Kit

EM1180 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: O88310
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Rat ITLN1(Intelectin 1/Omentin) ELISA Kit

ER1117 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Alias: ITLN1/HL-1/Itlna/LFR/Omentin/Endothelial lectin HL-1/Galactofuranose-binding lectin/hIntL/intelectin-1/INTLHL1/ITLNITLN-1/LFRIntestinal lactoferrin receptor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-48T 48T
EUR 332
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Intelectin 1 (ITLN1)

KTE71460-96T 96T
EUR 539
  • Omentin is a protein expressed and secreted from visceral but not subcutaneous adipose tissue that increases insulin sensitivity in human adipocytes. To determine the impact of obesity-dependent insulin resistance on the regulation of two omentin iso
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Intelectin 1 (ITLN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human ITLN1 (Intelectin 1/Omentin)

E-EL-H2028 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Mouse Intelectin 1 (ITLN1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Intelectin 1 (ITLN1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195758-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

abx036572-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Mouse Intelectin 1 (ITLN1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Intelectin 1 (ITLN1) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Intelectin 1 (ITLN1) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Intelectin 1/Omentin (ITLN1) Antibody

abx234415-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Intelectin 1/Omentin (ITLN1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse Intelectin- 1a, Itln1 ELISA KIT

ELI-03069m 96 Tests
EUR 865

Mouse Intelectin 1a (ITLN1) ELISA Kit

abx575109-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ITLN1 ELISA Kit| Rat Intelectin 1/Omentin ELISA Kit

EF017857 96 Tests
EUR 689

ITLN1 ELISA Kit| Mouse Intelectin 1/Omentin ELISA Kit

EF013735 96 Tests
EUR 689

ELISA kit for Mouse ITLN1 (Intelectin 1/Omentin)

E-EL-M0857 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat ITLN1 (Intelectin 1/Omentin)

E-EL-R0689 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Guinea pig Intelectin 1/Omentin (ITLN1) ELISA Kit

abx357571-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195759-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Intelectin 1/Omentin (ITLN1) CLIA Kit

abx195760-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

CLIA kit for Human ITLN1 (Intelectin 1/Omentin)

E-CL-H1228 1 plate of 96 wells
EUR 584
  • Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1)

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1)

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1)

CLIA kit for Mouse ITLN1 (Intelectin 1/Omentin)

E-CL-M0525 1 plate of 96 wells
EUR 584
  • Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Rat ITLN1 (Intelectin 1/Omentin)

E-CL-R0491 1 plate of 96 wells
EUR 584
  • Gentaur's ITLN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat ITLN1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat ITLN1 (Intelectin 1/Omentin) in samples from Serum, Plasma, Cell supernatant

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with PE.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with APC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with Biotin.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with Cy3.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with FITC.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with HRP.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Intelectin 1 (ITLN1) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Cys31~Gly253)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

Intelectin 1 (ITLN1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Arg28~Gly270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

Intelectin 1 (ITLN1) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ITLN1 (Ser101~Gly292)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Intelectin 1 (ITLN1). This antibody is labeled with APC-Cy7.

ELISA kit for Human Intelectin-1

EK2456 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Intelectin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.


ELA-E0933h 96 Tests
EUR 824


EF000363 96 Tests
EUR 689


STJ150467 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ITLN1 in human serum, plasma and other biological fluids

Human Omentin/intelectin-1 PicoKine ELISA Kit

EK1849 96 wells
EUR 425
Description: For quantitative detection of human Omentin/intelectin-1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

ITLN1 ELISA Kit (Human) (OKAN04670)

OKAN04670 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL

ITLN1 ELISA Kit (Human) (OKBB01263)

OKBB01263 96 Wells
EUR 505
Description: Description of target: Intelectin-1, also known as omentin or intestinal lactoferrin receptor, is an intelectin encoded in humans by the ITLN1 gene. It is mapped to 1q23.3. Intelectin-1 functions both as a receptor for bacterial arabinogalactans and for lactoferrin. Having conserved ligand binding site residues, both human and mouse intelectin-1 bind the exocyclic vicinal diol of carbohydrate ligands such as galactofuranose.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

ITLN1 ELISA Kit (Human) (OKCD06996)

OKCD06996 96 Wells
EUR 753
Description: Description of target: ITLN1 has no effect on basal glucose uptake but enhances insulin-stimulated glucose uptake in adipocytes.ITLN1 increases AKT phosphorylation in the absence and presence of insulin. ITLN1 may play a role in the defense system against microorganisms. ITLN1 may specifically recognize carbohydrate chains of pathogens and bacterial components containing galactofuranosyl residues, in a calcium-dependent manner. ITLN1 may be involved in iron metabolism.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

Human Intelectin 2 (ITLN2)ELISA Kit

201-12-2755 96 tests
EUR 440
  • This Intelectin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

DLR-ITLN2-Hu-48T 48T
EUR 517
  • Should the Human Intelectin 2 (ITLN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 2 (ITLN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

DLR-ITLN2-Hu-96T 96T
EUR 673
  • Should the Human Intelectin 2 (ITLN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Intelectin 2 (ITLN2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Intelectin 2 (ITLN2) ELISA Kit

abx252683-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ITLN2(Intelectin 2) ELISA Kit

EH3280 96T
EUR 524.1
  • Detection range: 6.25-400 ng/ml
  • Uniprot ID: Q8WWU7
  • Alias: ITLN2/Endothelial lectin HL-2/HL-2/Intelectin-b/Itln1b/ITLN2/Itlnb/HL-2/intelectin 2/UNQ2789/PRO7179
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 3.75 ng/ml

Human Intelectin- 2, ITLN2 ELISA KIT

ELI-28050h 96 Tests
EUR 824

Human Intelectin 2(ITLN2)ELISA Kit

QY-E02126 96T
EUR 361

Human Intelectin 2 (ITLN2) ELISA Kit

RDR-ITLN2-Hu-48Tests 48 Tests
EUR 544

Human Intelectin 2 (ITLN2) ELISA Kit

RDR-ITLN2-Hu-96Tests 96 Tests
EUR 756

Human Intelectin 2 (ITLN2) ELISA Kit

RD-ITLN2-Hu-48Tests 48 Tests
EUR 521

Human Intelectin 2 (ITLN2) ELISA Kit

RD-ITLN2-Hu-96Tests 96 Tests
EUR 723

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

SEH773Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Intelectin 2 (ITLN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Intelectin 2 (ITLN2) in serum, plasma and other biological fluids.

Human Intelectin 2 (ITLN2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Intelectin 2 elisa. Alternative names of the recognized antigen: HL-2
  • Endothelial lectin HL-2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Intelectin 2 (ITLN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.


E541-336 100ug
EUR 343

ITLN1 ELISA Kit (Mouse) (OKAN05847)

OKAN05847 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.9 pg/mL

Itln1 ELISA Kit (Rat) (OKCD01553)

OKCD01553 96 Wells
EUR 818
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.32 pg/mL

ITLN1 ELISA Kit (Mouse) (OKCD02664)

OKCD02664 96 Wells
EUR 779
Description: Description of target: Has no effect on basal glucose uptake but enhances insulin-stimulated glucose uptake in adipocytes. Increases AKT phosphorylation in the absence and presence of insulin. May play a role in the defense system against microorganisms. May specifically recognize carbohydrate chains of pathogens and bacterial components containing galactofuranosyl residues, in a calcium-dependent manner. May be involved in iron metabolism.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.9 pg/mL

ITLN1 ELISA Kit (Mouse) (OKEH07020)

OKEH07020 96 Wells
EUR 766
Description: Description of target: Lectin that specifically recognizes microbial carbohydrate chains in a calcium-dependent manner. Binds to microbial glycans that contain a terminal acyclic 1,2-diol moiety, including beta-linked D-galactofuranose (beta-Galf), D-phosphoglycerol-modified glycans, D-glycero-D-talo-oct-2-ulosonic acid (KO) and 3-deoxy-D-manno-oct-2-ulosonic acid (KDO). Binds to glycans from Gram-positive and Gram-negative bacteria, including K.pneumoniae, S.pneumoniae, Y.pestis, P.mirabilis and P.vulgaris. Does not bind mammalian glycans. Probably plays a role in the defense system against microorganisms. May function as adipokine that has no effect on basal glucose uptake but enhances insulin-stimulated glucose uptake in adipocytes. Increases AKT phosphorylation in the absence and presence of insulin. May interact with lactoferrin/LTF and increase its uptake, and may thereby play a role in iron absorption.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL

ITLN1 ELISA Kit (Rat) (OKEI00804)

OKEI00804 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

ELISA kit for Human ITLN2 (Intelectin 2)

E-EL-H5562 1 plate of 96 wells
EUR 534
  • Gentaur's ITLN2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ITLN2. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ITLN2 (Intelectin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human ITLN2 (Intelectin 2)

ELK3892 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Intelectin 2 (ITLN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Intelectin 2
  • Show more
Description: A sandwich ELISA kit for detection of Intelectin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human ITLN1 Protein

abx060058-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.

ITLN1 ELISA Kit (Human) : 96 Wells (OKEH00669)

OKEH00669 96 Wells
EUR 635
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL

Mouse Intelectin- 1b, Itln1b ELISA KIT

ELI-39394m 96 Tests
EUR 865

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human Intelectin 2 (ITLN2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ITLN1 protein

30R-2075 100 ug
EUR 305
Description: Purified recombinant ITLN1 protein

ITLN1 antibody

70R-18032 50 ul
EUR 435
Description: Rabbit polyclonal ITLN1 antibody

ITLN1 Antibody

36560-100ul 100ul
EUR 252

ITLN1 antibody

10R-10234 50 ul
EUR 241
Description: Mouse monoclonal ITLN1 antibody

ITLN1 antibody

10R-10369 100 ug
EUR 435
Description: Mouse monoclonal ITLN1 antibody

ITLN1 Antibody

DF12413 200ul
EUR 304
Description: ITLN1 antibody detects endogenous levels of ITLN1.

ITLN1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ITLN1. Recognizes ITLN1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

ITLN1 antibody

70R-8512 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ITLN1 antibody

ITLN1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ITLN1. Recognizes ITLN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ITLN1 Protein

  • EUR 328.00
  • EUR 6425.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ITLN1 Protein

  • EUR 328.00
  • EUR 7358.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human ITLN1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ITLN1 Recombinant Protein (Human)

RP016414 100 ug Ask for price

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

ITLN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1106702 1.0 ug DNA
EUR 154

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human Intelectin 2 (ITLN2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His)

CH39-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 .

Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His)

CH39-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 .

Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His)

CH39-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 .

Recombinant Human Omentin/Intelectin-1/ITLN-1 (N-6His)

CH39-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of 50mM Tris,100mMNaCl, 5mM GSH, 0.5mM GSSG,pH8.0 .


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ITLN1 Blocking Peptide

33R-10022 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ITLN1 antibody, catalog no. 70R-8512

ITLN1 Blocking Peptide

DF12413-BP 1mg
EUR 195

ITLN1 Conjugated Antibody

C36560 100ul
EUR 397

ITLN1 cloning plasmid

CSB-CL851976HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atgaaccaactcagcttcctgctgtttctcatagcgaccaccagaggatggagtacagatgaggctaatacttacttcaaggaatggacctgttcttcgtctccatctctgcccagaagctgcaaggaaatcaaagacgaatgtcctagtgcatttgatggcctgtattttctccg
  • Show more
Description: A cloning plasmid for the ITLN1 gene.

ITLN1 Rabbit pAb

A7234-100ul 100 ul
EUR 308

Human ITLN1(Intelectin 1) ELISA Kit