Human LUM(Lumican) ELISA Kit

Human LUM(Lumican) ELISA Kit

Human Lumican (LUM) ELISA Kit

RD-LUM-Hu-48Tests 48 Tests
EUR 500

Human Lumican (LUM) ELISA Kit

RD-LUM-Hu-96Tests 96 Tests
EUR 692

Human Lumican (LUM) ELISA Kit

RDR-LUM-Hu-48Tests 48 Tests
EUR 522

Human Lumican (LUM) ELISA Kit

RDR-LUM-Hu-96Tests 96 Tests
EUR 724

Human Lumican (LUM) ELISA Kit

abx573449-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human LUM/ Lumican ELISA Kit

E1518Hu 1 Kit
EUR 571

Human LUM(Lumican) ELISA Kit

EH0220 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P51884
  • Alias: Lumican/LUM/LDC/SLRR2D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Lumican, LUM ELISA KIT

ELI-04938h 96 Tests
EUR 824

Human lumican(LUM)ELISA Kit

GA-E1888HM-48T 48T
EUR 289

Human lumican(LUM)ELISA Kit

GA-E1888HM-96T 96T
EUR 466

Human Lumican (LUM) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Lumican (LUM) ELISA Kit

abx251541-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human lumican,LUM ELISA Kit

201-12-1872 96 tests
EUR 440
  • This lumican ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human lumican, LUM ELISA Kit

CSB-E09797h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human lumican, LUM in samples from serum, urine, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human lumican, LUM ELISA Kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human lumican, LUM in samples from serum, urine, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Lumican (LUM) ELISA Kit

SEB496Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Lumican (LUM) ELISA Kit

SEB496Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Lumican (LUM) ELISA Kit

SEB496Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Lumican (LUM) ELISA Kit

SEB496Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Lumican (LUM) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Lumican (LUM) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Lumican (LUM) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lumican elisa. Alternative names of the recognized antigen: LDC
  • SLRR2D
  • KSPG lumican
  • Keratan sulfate proteoglycan lumican
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Lumican (LUM) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human lumican(LUM)ELISA Kit

QY-E03003 96T
EUR 361

Cow Lumican (LUM) ELISA Kit

abx517282-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Lumican (LUM) ELISA Kit

abx517283-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Lumican (LUM) ELISA Kit

abx517285-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Lum/ Lumican ELISA Kit

E0582Ra 1 Kit
EUR 571

Mouse Lum/ Lumican ELISA Kit

E0904Mo 1 Kit
EUR 571

Bovine Lumican, LUM ELISA KIT

ELI-04933b 96 Tests
EUR 928

Mouse Lumican, Lum ELISA KIT

ELI-04934m 96 Tests
EUR 865

Rabbit Lumican, LUM ELISA KIT

ELI-04936Ra 96 Tests
EUR 928

Chicken Lumican, LUM ELISA KIT

ELI-04937c 96 Tests
EUR 928

Rat Lum(Lumican) ELISA Kit

ER0046 96T
EUR 567.6
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P51886
  • Alias: Lumican/LUM/LDC/SLRR2D/Keratan sulfate proteoglycan lumican/KSPG lumican
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

Mouse Lumican (LUM) ELISA Kit

abx350774-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Chicken Lumican (LUM) ELISA Kit

abx354656-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Lumican (LUM) ELISA Kit

abx354948-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Lumican (LUM) ELISA Kit

abx355098-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Lumican (LUM) ELISA Kit

abx355262-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Lumican (Lum) ELISA Kit

abx255626-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Lumican(LUM) ELISA kit

CSB-EL013234MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lumican (LUM) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Lumican(LUM) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Lumican(LUM) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Lumican(LUM) ELISA kit

CSB-EL013234RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Lumican (LUM) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Lumican(LUM) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Lumican(LUM) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human LUM (Lumican)

ELK2021 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Lumican (LUM). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Lumican (LUM). Next,
  • Show more
Description: A sandwich ELISA kit for detection of Lumican from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human LUM (Lumican)

E-EL-H0198 1 plate of 96 wells
EUR 534
  • Gentaur's LUM ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human LUM. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human LUM (Lumican) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Lumican (LUM)

KTE62236-48T 48T
EUR 354
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lumican (LUM)

KTE62236-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Lumican (LUM)

KTE62236-96T 96T
EUR 572
  • Lumican is a member of the small leucine-rich proteoglycan family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. The protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans re
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Lumican (LUM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Lumican (LUM) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lumican (LUM) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lumican (LUM) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lumican (LUM) Antibody

abx033510-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx033510-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx033511-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx033511-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Lumican (Lum) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody

abx234890-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Lumican (LUM) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat Lumican (Lum)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in E.coli

Rat Lumican (Lum)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 40.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Lumican(Lum) expressed in Mammalian cell

Recombinant Lumican (LUM)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51884
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.1kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Lumican expressed in: E.coli

Recombinant Lumican (LUM)

  • EUR 470.94
  • EUR 229.00
  • EUR 1491.04
  • EUR 563.68
  • EUR 1027.36
  • EUR 378.00
  • EUR 3577.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51885
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.8kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Lumican expressed in: E.coli

Human Lumican (LUM) CLIA Kit

abx195959-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Lumican (LUM) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Lumican (LUM) Protein

  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Guinea pig Lumican (LUM) ELISA Kit

abx354788-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Mouse LUM (Lumican)

E-EL-M1309 1 plate of 96 wells
EUR 534
  • Gentaur's LUM ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse LUM. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse LUM (Lumican) in samples from Serum, Plasma, Cell supernatant

Lum ELISA Kit| Rat Lumican ELISA Kit

EF017042 96 Tests
EUR 689

Mouse Lumican (LUM) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2012.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Lumican (LUM) Antibody (FITC)

  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Lumican (Lum) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (Lum) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (Lum) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lumican (LUM) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Lumican (LUM) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Lumican (LUM) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM)

Lumican (LUM) Monoclonal Antibody (Human)

  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM)

Recombinant Human Lumican/LUM Protein

RP00216 10 μg
EUR 155

Recombinant Human Lumican/LUM (C-6His)

C372-10ug 10ug
EUR 131
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 1mM EDTA, pH 7.2.

Recombinant Human Lumican/LUM (C-6His)

C372-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 1mM EDTA, pH 7.2.

Recombinant Human Lumican/LUM (C-6His)

C372-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 1mM EDTA, pH 7.2.

Recombinant Human Lumican/LUM (C-6His)

C372-50ug 50ug
EUR 273
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, 1mM EDTA, pH 7.2.

Lumican (LUM) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with PE.

Lumican (LUM) Monoclonal Antibody (Human), APC

  • EUR 346.00
  • EUR 3293.00
  • EUR 917.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Monoclonal Antibody (Human), Biotinylated

  • EUR 312.00
  • EUR 2473.00
  • EUR 730.00
  • EUR 382.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Monoclonal Antibody (Human), Cy3

  • EUR 420.00
  • EUR 4349.00
  • EUR 1181.00
  • EUR 547.00
  • EUR 252.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Monoclonal Antibody (Human), FITC

  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Monoclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2870.00
  • EUR 811.00
  • EUR 399.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Monoclonal Antibody (Human), PE

  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with PE.

Lumican (LUM) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM)

Lumican (LUM) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Lumican (LUM). This antibody is labeled with APC-Cy7.

Lumican (LUM) Monoclonal Antibody (Human), APC-Cy7

  • EUR 572.00
  • EUR 6466.00
  • EUR 1714.00
  • EUR 763.00
  • EUR 320.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gln19~Asn338
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Lumican (LUM). This antibody is labeled with APC-Cy7.

Lumican (LUM) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with APC.

Lumican (LUM) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with Biotin.

Lumican (LUM) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with Cy3.

Lumican (LUM) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with FITC.

Lumican (LUM) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with HRP.

Lumican (LUM) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with PE.

Lumican (LUM) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LUM (Gln19~Asn338)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Lumican (LUM). This antibody is labeled with APC-Cy7.

Recombinant Rat Lumican/ LUM Protein, His, E.coli-100ug

QP6324-ec-100ug 100ug
EUR 571

Recombinant Rat Lumican/ LUM Protein, His, E.coli-10ug

QP6324-ec-10ug 10ug
EUR 272

Recombinant Rat Lumican/ LUM Protein, His, E.coli-1mg

QP6324-ec-1mg 1mg
EUR 2303

Recombinant Rat Lumican/ LUM Protein, His, E.coli-200ug

QP6324-ec-200ug 200ug
EUR 898

Recombinant Rat Lumican/ LUM Protein, His, E.coli-500ug

QP6324-ec-500ug 500ug
EUR 1514

Recombinant Rat Lumican/ LUM Protein, His, E.coli-50ug

QP6324-ec-50ug 50ug
EUR 362

Recombinant Rat Lumican/ LUM Protein, His, Mammal-100ug

QP6324-ma-100ug 100ug
EUR 1178

Recombinant Rat Lumican/ LUM Protein, His, Mammal-20ug

QP6324-ma-20ug 20ug
EUR 462

Recombinant Rat Lumican/ LUM Protein, His, Mammal-50ug

QP6324-ma-50ug 50ug
EUR 862

Lum/ Rat Lum ELISA Kit

ELI-04935r 96 Tests
EUR 886

Lumican (Human) ELISA Kit

E4809-100 96 assay
EUR 784


ELA-E1496h 96 Tests
EUR 824


EF000178 96 Tests
EUR 689

ELISA kit for Human Lumican

EK3518 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Lumican in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Lumican PicoKine ELISA Kit

EK1244 96 wells
EUR 425
Description: For quantitative detection of human Lumican in cell culture supernates, serum and plasma(heparin).

Lumican ELISA Kit (Human) (OKBB00559)

OKBB00559 96 Wells
EUR 505
Description: Description of target: Lumican, also known as LUM, is a protein which in humans is encoded by the LUM gene. This gene is a member of the small interstitial proteoglycan gene (SIPG) family, and it is a keratan sulfate proteoglycan which presents large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle, skin, and intervertebral discs. Lumican is mapped to 12q21.33, it interacts with collagen and limits growth of fibrils in diameter. In the cornea, Lumican not only interacts with collagen molecules to limit fibril growth, but also plays a critical role in the regular spacing of fibrils and acquisition of corneal transparency by virtue of its keratan sulfate-containing glycosaminoglycan side chains LDC.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Lumican (Mouse) ELISA Kit

E4808-100 96assay
EUR 753

Lumican (Rat) ELISA Kit

E4810-100 96 assay
EUR 784

LUM ELISA Kit (Human) (OKCD07441)

OKCD07441 96 Wells
EUR 936
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.124ng/mL

ELISA kit for Rat Lumican

EK3519 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Lumican in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Lumican

EK5561 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Lumican in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Lumican PicoKine ELISA Kit

EK1261 96 wells
EUR 425
Description: For quantitative detection of mouse Lumican in cell culture supernates, serum and plasma(heparin).

Rat Lumican PicoKine ELISA Kit

EK1262 96 wells
EUR 425
Description: For quantitative detection of rat Lumican in cell culture supernates, serum and plasma(heparin).

Lumican ELISA Kit (Mouse) (OKBB00569)

OKBB00569 96 Wells
EUR 505
Description: Description of target: Lumican, also known as LUM, is a protein which in humans is encoded by the LUM gene. This gene is a member of the small interstitial proteoglycan gene (SIPG) family, and it is a keratan sulfate proteoglycan which presents large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle, skin, and intervertebral discs. Lumican is mapped to 12q21.33, it interacts with collagen and limits growth of fibrils in diameter. In the cornea, Lumican not only interacts with collagen molecules to limit fibril growth, but also plays a critical role in the regular spacing of fibrils and acquisition of corneal transparency by virtue of its keratan sulfate-containing glycosaminoglycan side chains LDC.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Lumican ELISA Kit (Rat) (OKBB00570)

OKBB00570 96 Wells
EUR 505
Description: Description of target: Lumican, also known as LUM, is a protein which in humans is encoded by the LUM gene. This gene is a member of the small interstitial proteoglycan gene (SIPG) family, and it is a keratan sulfate proteoglycan which presents large quantities in the corneal stroma and in interstitial collagenous matrices of the heart, aorta, skeletal muscle, skin, and intervertebral discs. Lumican is mapped to 12q21.33, it interacts with collagen and limits growth of fibrils in diameter. In the cornea, Lumican not only interacts with collagen molecules to limit fibril growth, but also plays a critical role in the regular spacing of fibrils and acquisition of corneal transparency by virtue of its keratan sulfate-containing glycosaminoglycan side chains LDC.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Human Lumican Antibody

32276-05111 150 ug
EUR 261

General Lumisterol (Lum) ELISA Kit

CES509Ge-10x96wellstestplate 10x96-wells test plate
EUR 6027.41
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lumisterol (Lum) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lumisterol (Lum) in serum, plasma and other biological fluids.

General Lumisterol (Lum) ELISA Kit

CES509Ge-1x48wellstestplate 1x48-wells test plate
EUR 584.02
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lumisterol (Lum) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lumisterol (Lum) in serum, plasma and other biological fluids.

General Lumisterol (Lum) ELISA Kit

CES509Ge-1x96wellstestplate 1x96-wells test plate
EUR 791.46
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lumisterol (Lum) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lumisterol (Lum) in serum, plasma and other biological fluids.

General Lumisterol (Lum) ELISA Kit

CES509Ge-5x96wellstestplate 5x96-wells test plate
EUR 3261.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of General Lumisterol (Lum) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of General Lumisterol (Lum) in serum, plasma and other biological fluids.

General Lumisterol (Lum) ELISA Kit

  • EUR 6078.00
  • EUR 3212.00
  • EUR 792.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Lumisterol elisa. Alternative names of the recognized antigen: VD
  • VD1
  • Lamisterol
  • Vitamin D
  • Vitamin D1
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of General Lumisterol (Lum) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

LUM ELISA Kit (Rat) (OKCA01900)

OKCA01900 96 Wells
EUR 846
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

Lum ELISA Kit (Rat) (OKEH04582)

OKEH04582 96 Wells
EUR 662
Description: Description of target: Member of leucine-rich proteoglycan family; may play a role in immature and transient fibrosis of acute pancreatitis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.316 ng/mL

LUM ELISA Kit (Mouse) (OKEH07051)

OKEH07051 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.176 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

LUM ELISA Kit (Human) : 96 Wells (OKEH02823)

OKEH02823 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Lumican siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Lumican siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Lumican siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Lumican Antibody

49986-100ul 100ul
EUR 333

Lumican Antibody

49986-50ul 50ul
EUR 239


YF-PA12992 50 ug
EUR 363
Description: Mouse polyclonal to Lumican


YF-PA12993 100 ug
EUR 403
Description: Rabbit polyclonal to Lumican

Lumican Human Recombinant Protein

PROTP51884 Regular: 20ug
EUR 317
Description: LUM Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 343 amino acids (19-338a.a) and having a molecular mass of 39kDa._x000D_ LUM is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for General Lum (Lumisterol)

ELK7984 1 plate of 96 wells
EUR 372
  • A monoclonal antibody specific to Lumisterol (Lum) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Lumisterol (Lum) and unlabeled Lumisterol (Lum) (Standards or samples) with the pre-coated
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Lumisterol from General in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

LUM antibody

70R-9283 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal LUM antibody

LUM Antibody

ABD7293 100 ug
EUR 438

LUM Antibody

36591-100ul 100ul
EUR 252

LUM antibody

70R-18332 50 ul
EUR 435
Description: Rabbit polyclonal LUM antibody

LUM Antibody

DF7293 200ul
EUR 304
Description: LUM Antibody detects endogenous levels of total LUM.

LUM Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LUM Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Lum Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

LUM Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

LUM Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LUM. Recognizes LUM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

Human LUM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LUM Recombinant Protein (Human)

RP018424 100 ug Ask for price

LUM Recombinant Protein (Human)

RP018427 100 ug Ask for price

Lumican Conjugated Antibody

C49986 100ul
EUR 397

anti- Lumican antibody

FNab04890 100µg
EUR 505.25
  • Immunogen: lumican
  • Uniprot ID: P51884
  • Research Area: Neuroscience, Cardiovascular, Signal Transduction
Description: Antibody raised against Lumican

Anti-Lumican Antibody

A01034-1 100ug/vial
EUR 334

Lumican Rabbit mAb

A11593-100ul 100 ul
EUR 410

Lumican Rabbit mAb

A11593-200ul 200 ul
EUR 571

Lumican Rabbit mAb

A11593-20ul 20 ul
EUR 221

Lumican Rabbit mAb

A11593-50ul 50 ul
EUR 287

Anti-Lumican Antibody

PB9662 100ug/vial
EUR 334

Anti-Lumican antibody

PAab04890 100 ug
EUR 355

Human Lumican Antibody (Biotin Conjugate)

32276-05121 150 ug
EUR 369

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

LUM Conjugated Antibody

C36591 100ul
EUR 397

LUM cloning plasmid

CSB-CL013234HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.

LUM cloning plasmid

CSB-CL013234HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1017
  • Sequence: atgagtctaagtgcatttactctcttcctggcattgattggtggtaccagtggccagtactatgattatgattttcccctatcaatttatgggcaatcatcaccaaactgtgcaccagaatgtaactgccctgaaagctacccaagtgccatgtactgtgatgagctgaaattga
  • Show more
Description: A cloning plasmid for the LUM gene.

LUM Polyclonal Antibody

ES11180-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LUM Polyclonal Antibody

ES11180-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LUM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LUM Polyclonal Antibody

ABP59166-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody

ABP59166-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Polyclonal Antibody

ABP59166-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of LUM from Human, Mouse, Rat. This LUM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LUM protein at amino acid sequence of 30-110

LUM Rabbit pAb

A5352-100ul 100 ul
EUR 308

LUM Rabbit pAb

A5352-200ul 200 ul
EUR 459

LUM Rabbit pAb

A5352-20ul 20 ul
EUR 183

LUM Rabbit pAb

A5352-50ul 50 ul
EUR 223

LUM Blocking Peptide

33R-1163 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C9orf96 antibody, catalog no. 70R-1210

LUM Blocking Peptide

DF7293-BP 1mg
EUR 195

Anti-LUM antibody

STJ27305 100 µl
EUR 277
Description: This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family that includes decorin, biglycan, fibromodulin, keratocan, epiphycan, and osteoglycin. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair.

Anti-LUM antibody

STJ192338 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LUM

Human, Lumican Human Recombinant Protein, Sf9

PROTP51884-1 Regular: 10ug
EUR 317
Description: LUM Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 329 amino acids (19-338 aa) and having a molecular mass of 37.7kDa (Migrates at 40-57kDa on SDS-PAGE under reducing conditions).;LUM is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

LUM ORF Vector (Human) (pORF)

ORF006142 1.0 ug DNA
EUR 95

LUM ORF Vector (Human) (pORF)

ORF006143 1.0 ug DNA
EUR 95

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human Lumican AssayLite Antibody (FITC Conjugate)

32276-05141 150 ug
EUR 428

Human Lumican AssayLite Antibody (RPE Conjugate)

32276-05151 150 ug
EUR 428

Human Lumican AssayLite Antibody (APC Conjugate)

32276-05161 150 ug
EUR 428

Human Lumican AssayLite Antibody (PerCP Conjugate)

32276-05171 150 ug
EUR 471

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Polyclonal LUM Antibody (Center)

APR05952G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LUM (Center). This antibody is tested and proven to work in the following applications:

Rat LUM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LUM protein (His tag)

80R-3624 100 ug
EUR 327
Description: Purified recombinant LUM protein (His tag)

Mouse LUM shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Lum Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Lum Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Lum Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Lum. Recognizes Lum from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

LUM Recombinant Protein (Rat)

RP210287 100 ug Ask for price

Human LUM(Lumican) ELISA Kit