Human TALDO1(Transaldolase) ELISA Kit

Human TALDO1(Transaldolase) ELISA Kit

Human Transaldolase (TALDO1) ELISA Kit
RD-TALDO1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Transaldolase (TALDO1) ELISA Kit
RD-TALDO1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Transaldolase (TALDO1) ELISA Kit
RDR-TALDO1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Transaldolase (TALDO1) ELISA Kit
RDR-TALDO1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Transaldolase (TALDO1)
1-CSB-RP042754h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 63.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transaldolase(TALDO1),partial expressed in E.coli

Human Transaldolase (TALDO1) ELISA Kit
20-abx153373	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transaldolase (TALDO1) ELISA Kit
abx253719-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human TALDO1/ Transaldolase ELISA Kit
E2442Hu	Sunlong	1 Kit	EUR 571

Human TALDO1(Transaldolase) ELISA Kit
EH0761	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P37837 Alias: TALDO1(Transaldolase)/TAL/TALDOR/TALH/TAL-H
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transaldolase (TALDO1) ELISA Kit
abx570176-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Transaldolase (TALDO1) ELISA Kit
SEB371Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit
SEB371Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit
SEB371Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit
SEB371Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit
4-SEB371Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transaldolase elisa. Alternative names of the recognized antigen: TAL TALDO TALDOR Transaldolase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transaldolase (TALDO1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Transaldolase (TALDO1) ELISA Kit
abx572386-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Cow Transaldolase (TALDO1) ELISA Kit
abx512162-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Transaldolase (TALDO1) ELISA Kit
abx512164-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Pig Transaldolase (TALDO1) ELISA Kit
abx512165-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Transaldolase (TALDO1) Antibody
20-abx005186	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody
20-abx178642	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Transaldolase (TALDO1) Antibody
20-abx178643	Abbexa	EUR 1247.00 EUR 592.00	1 mg 200 ug
Please enquire.

Transaldolase (TALDO1) Antibody
20-abx101410	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transaldolase (TALDO1) Antibody
20-abx110657	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody
20-abx141908	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody
20-abx174856	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Transaldolase (TALDO1) Antibody
abx032929-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody
abx032929-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody
abx238494-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Transaldolase (TALDO1) Antibody
20-abx241929	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody
20-abx241930	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Transaldolase (TALDO1)
4-RPB371Mu01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q93092 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.1kDa Isoelectric Point: 7.8
Description: Recombinant Mouse Transaldolase expressed in: E.coli

ELISA kit for Human TALDO1 (Transaldolase)
ELK1901	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transaldolase (TALDO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transaldola Show more
Description: A sandwich ELISA kit for detection of Transaldolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Transaldolase (TALDO1)
KTE60464-48T	Abbkine	48T	EUR 332
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transaldolase (TALDO1)
KTE60464-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transaldolase (TALDO1)
KTE60464-96T	Abbkine	96T	EUR 539
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Transaldolase (TALDO1) CLIA Kit
20-abx492701	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Transaldolase (TALDO1) Protein
20-abx655278	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Rat Transaldolase (TALDO1)
KTE100179-48T	Abbkine	48T	EUR 332
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transaldolase (TALDO1)
KTE100179-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transaldolase (TALDO1)
KTE100179-96T	Abbkine	96T	EUR 539
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transaldolase (TALDO1)
KTE10093-48T	Abbkine	48T	EUR 354
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transaldolase (TALDO1)
KTE10093-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transaldolase (TALDO1)
KTE10093-96T	Abbkine	96T	EUR 572
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transaldolase (TALDO1)
KTE80030-48T	Abbkine	48T	EUR 354
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transaldolase (TALDO1)
KTE80030-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transaldolase (TALDO1)
KTE80030-96T	Abbkine	96T	EUR 572
Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul Show more
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transaldolase (TALDO1)
KTE70332-48T	Abbkine	48T	EUR 332
Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transaldolase (TALDO1)
KTE70332-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transaldolase (TALDO1)
KTE70332-96T	Abbkine	96T	EUR 539
Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Transaldolase (TALDO1) Antibody Pair
abx117467-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Mouse Transaldolase (TALDO1) Protein
20-abx069394	Abbexa	EUR 690.00 EUR 286.00 EUR 2110.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Transaldolase (TALDO1) Protein
20-abx655279	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

TALDO1 Transaldolase Human Recombinant Protein
PROTP37837	BosterBio	Regular: 25ug	EUR 317
Description: TALDO1 Human Recombinant protein produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 357 amino acids (1-337) and having a molecular mass of 39.7 kDa. TALDO1 is fused to 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques.

Transaldolase 1 (TALDO1) polyclonal antibody
ABP-PAB-11692	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Recombinant Human Transaldolase/TALDO1 (C-6His)
C837-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Recombinant Human Transaldolase/TALDO1 (C-6His)
C837-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Recombinant Human Transaldolase/TALDO1 (C-6His)
C837-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Recombinant Human Transaldolase/TALDO1 (C-6His)
C837-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse)
4-PAB371Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1)

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), APC
4-PAB371Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with APC.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), Biotinylated
4-PAB371Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with Biotin.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), Cy3
4-PAB371Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with Cy3.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), FITC
4-PAB371Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with FITC.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), HRP
4-PAB371Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with HRP.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), PE
4-PAB371Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with PE.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), APC-Cy7
4-PAB371Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TALDO1 (Asp35~Glu285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with APC-Cy7.

Human TALDO1 ELISA Kit
ELA-E0198h	Lifescience Market	96 Tests	EUR 824

TALDO1 ELISA KIT|Human
EF000491	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Transaldolase
EK1473	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transaldolase in samples from serum, plasma, tissue homogenates and other biological fluids.

TALDO1 ELISA Kit (Human) (OKCD07365)
OKCD07365	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: Recombinant Human Transaldolase;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

TALDO1 ELISA Kit (Human) (OKEH04154)
OKEH04154	Aviva Systems Biology	96 Wells	EUR 1014
Description: Description of target: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Recombinant Human Transaldolase
7-03628	CHI Scientific	5µg	Ask for price

Recombinant Human Transaldolase
7-03629	CHI Scientific	25µg	Ask for price

Recombinant Human Transaldolase
7-03630	CHI Scientific	1mg	Ask for price

TALDO1 ELISA Kit (Mouse) (OKEH05906)
OKEH05906	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

TALDO1 ELISA Kit (Rat) (OKEH07179)
OKEH07179	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Transaldolase antibody
70R-15401	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Transaldolase antibody

Transaldolase (Recombinant)
20-abx073275	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TALDO1 antibody
70R-20701	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TALDO1 antibody

TALDO1 antibody
39160-100ul	SAB	100ul	EUR 252

TALDO1 Antibody
42784-100ul	SAB	100ul	EUR 252

TALDO1 Antibody
1-CSB-PA977634	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TALDO1 Antibody
DF12764	Affbiotech	200ul	EUR 304
Description: TALDO1 Antibody detects endogenous levels of TALDO1.

TALDO1 Antibody
1-CSB-PA04275A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

TALDO1 Antibody
1-CSB-PA217736	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TALDO1 Antibody
1-CSB-PA023112GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TALDO1 siRNA
20-abx905451	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TALDO1 siRNA
20-abx936008	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TALDO1 siRNA
20-abx936009	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Transaldolase antibody (FITC)
60R-1996	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Transaldolase antibody (FITC)

Transaldolase antibody (biotin)
60R-1997	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Transaldolase antibody (biotin)

Transaldolase antibody (HRP)
60R-2009	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Transaldolase antibody (HRP)

Transaldolase Polyclonal Antibody
42412-100ul	SAB	100ul	EUR 333

Transaldolase Antibody (Biotin)
20-abx106393	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transaldolase Antibody (FITC)
20-abx107805	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Transaldolase Antibody (HRP)
20-abx109223	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

anti-Transaldolase 1
YF-PA14912	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Transaldolase 1

anti-Transaldolase 1
YF-PA14913	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Transaldolase 1

anti-Transaldolase 1
YF-PA14914	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Transaldolase 1

Human TALDO1 shRNA Plasmid
20-abx954717	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TALDO1 Recombinant Protein (Human)
RP030898	ABM	100 ug	Ask for price

TALDO1 Recombinant Protein (Human)
RP030901	ABM	100 ug	Ask for price

TALDO1 Rabbit pAb
A13551-100ul	Abclonal	100 ul	EUR 308

TALDO1 Rabbit pAb
A13551-200ul	Abclonal	200 ul	EUR 459

TALDO1 Rabbit pAb
A13551-20ul	Abclonal	20 ul	EUR 183

TALDO1 Rabbit pAb
A13551-50ul	Abclonal	50 ul	EUR 223

TALDO1 Blocking Peptide
DF12764-BP	Affbiotech	1mg	EUR 195

TALDO1 Conjugated Antibody
C42784	SAB	100ul	EUR 397

TALDO1 Conjugated Antibody
C39160	SAB	100ul	EUR 397

TALDO1 cloning plasmid
CSB-CL023112HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1014 Sequence: atgtcgagctcacccgtgaagcgtcagaggatggagtccgcgctggaccagctcaagcagttcaccaccgtggtggccgacacgggcgacttccacgccatcgacgagtacaagccccaggatgctaccaccaacccgtccctgatcctggccgcagcacagatgcccgcttacc Show more
Description: A cloning plasmid for the TALDO1 gene.

TALDO1 cloning plasmid
CSB-CL023112HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 957 Sequence: atgtcgagctcacccgtgaagcgtcagaggatggagtccgcgctggaccagctcaagcagttcaccaccgtggtggccgacacgggcgacttccacgccatcgacgagtacaagccccaggatgctaccaccaacccgtccctgatcctggccgcagcacagatgcccgcttacca Show more
Description: A cloning plasmid for the TALDO1 gene.

TALDO1 Rabbit pAb
A6762-100ul	Abclonal	100 ul	EUR 308

TALDO1 Rabbit pAb
A6762-200ul	Abclonal	200 ul	EUR 459

TALDO1 Rabbit pAb
A6762-20ul	Abclonal	20 ul	EUR 183

TALDO1 Rabbit pAb
A6762-50ul	Abclonal	50 ul	EUR 223

TALDO1 Polyclonal Antibody
A51941	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- TALDO1 antibody
FNab08494	FN Test	100µg	EUR 548.75
Immunogen: transaldolase 1 Uniprot ID: P37837 Gene ID: 6888 Research Area: Metabolism
Description: Antibody raised against TALDO1

Anti-TALDO1 antibody
PAab08494	Lifescience Market	100 ug	EUR 386

Anti-TALDO1 antibody
STJ28845	St John's Laboratory	100 µl	EUR 277
Description: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis.

Anti-TALDO1 antibody
STJ115512	St John's Laboratory	100 µl	EUR 277
Description: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis.

Transaldolase 1 Polyclonal Antibody
20-abx116938	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Transaldolase Polyclonal Conjugated Antibody
C42412	SAB	100ul	EUR 397

TALDO1 ORF Vector (Human) (pORF)
ORF010300	ABM	1.0 ug DNA	EUR 95

TALDO1 ORF Vector (Human) (pORF)
ORF010301	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Polyclonal TALDO1 Antibody (Center)
APR10377G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TALDO1 (Center). This antibody is tested and proven to work in the following applications:

TALDO1 Antibody, HRP conjugated
1-CSB-PA04275B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TALDO1 Antibody, FITC conjugated
1-CSB-PA04275C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TALDO1 Antibody, Biotin conjugated
1-CSB-PA04275D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TALDO1 protein (His tag)
80R-1428	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human TALDO1 protein

Mouse TALDO1 shRNA Plasmid
20-abx972990	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TALDO1 shRNA Plasmid
20-abx986834	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TALDO1 Recombinant Protein (Rat)
RP232223	ABM	100 ug	Ask for price

TALDO1 Recombinant Protein (Mouse)
RP177176	ABM	100 ug	Ask for price

TALDO1 sgRNA CRISPR Lentivector set (Human)
K2330801	ABM	3 x 1.0 ug	EUR 339

Escherichia coli Transaldolase B (talB)
1-CSB-EP359086ENV	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 42.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Transaldolase B(talB) expressed in E.coli

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Recombinant Human Transaldolase Protein, GST, E.coli-100ug
QP8473-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human Transaldolase Protein, GST, E.coli-10ug
QP8473-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human Transaldolase Protein, GST, E.coli-1mg
QP8473-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human Transaldolase Protein, GST, E.coli-200ug
QP8473-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human Transaldolase Protein, GST, E.coli-500ug
QP8473-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human Transaldolase Protein, GST, E.coli-50ug
QP8473-ec-50ug	EnQuireBio	50ug	EUR 263

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

TALDO1 Polyclonal Antibody, HRP Conjugated
A57608	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

TALDO1 Polyclonal Antibody, FITC Conjugated
A57609	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TALDO1 Polyclonal Antibody, Biotin Conjugated
A57610	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Taldo1 ORF Vector (Rat) (pORF)
ORF077409	ABM	1.0 ug DNA	EUR 506

m Taldo1 inducible lentiviral particles
LVP538	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing mouse target: Taldo1 (transaldolase 1), [alternative names: None]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_011528.4. It also contains a RFP-Blasticidin dual selection marker.

Taldo1 ORF Vector (Mouse) (pORF)
ORF059060	ABM	1.0 ug DNA	EUR 506

TALDO1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2330802	ABM	1.0 ug DNA	EUR 154

TALDO1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2330803	ABM	1.0 ug DNA	EUR 154

TALDO1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2330804	ABM	1.0 ug DNA	EUR 154

TALDO1 Protein Vector (Human) (pPB-C-His)
PV041197	ABM	500 ng	EUR 329

TALDO1 Protein Vector (Human) (pPB-N-His)
PV041198	ABM	500 ng	EUR 329

TALDO1 Protein Vector (Human) (pPM-C-HA)
PV041199	ABM	500 ng	EUR 329

TALDO1 Protein Vector (Human) (pPM-C-His)
PV041200	ABM	500 ng	EUR 329

TALDO1 Protein Vector (Human) (pPB-C-His)
PV041201	ABM	500 ng	EUR 329

TALDO1 Protein Vector (Human) (pPB-N-His)
PV041202	ABM	500 ng	EUR 329

TALDO1 Protein Vector (Human) (pPM-C-HA)
PV041203	ABM	500 ng	EUR 329

TALDO1 Protein Vector (Human) (pPM-C-His)
PV041204	ABM	500 ng	EUR 329

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

TALDO1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715653	ABM	1.0 ug DNA	EUR 316

TALDO1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715657	ABM	1.0 ug DNA	EUR 316

TALDO1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715658	ABM	1.0 ug DNA	EUR 316

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Taldo1 sgRNA CRISPR Lentivector set (Rat)
K7103201	ABM	3 x 1.0 ug	EUR 339

Taldo1 sgRNA CRISPR Lentivector set (Mouse)
K3983901	ABM	3 x 1.0 ug	EUR 339

Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320)
VAng-Lsx4263-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3677
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein.

Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320)
VAng-Lsx4263-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2495
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein.

Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320)
VAng-Lsx4263-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1700
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein.

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

Human TALDO1(Transaldolase) ELISA Kit