Human TALDO1(Transaldolase) ELISA Kit
Human Transaldolase (TALDO1) ELISA Kit |
RD-TALDO1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Transaldolase (TALDO1) ELISA Kit |
RD-TALDO1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Transaldolase (TALDO1) ELISA Kit |
RDR-TALDO1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Transaldolase (TALDO1) ELISA Kit |
RDR-TALDO1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Transaldolase (TALDO1) |
1-CSB-RP042754h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 63.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Transaldolase(TALDO1),partial expressed in E.coli |
Human Transaldolase (TALDO1) ELISA Kit |
20-abx153373 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Transaldolase (TALDO1) ELISA Kit |
abx253719-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Human TALDO1/ Transaldolase ELISA Kit |
E2442Hu |
Sunlong |
1 Kit |
EUR 571 |
Human TALDO1(Transaldolase) ELISA Kit |
EH0761 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P37837
- Alias: TALDO1(Transaldolase)/TAL/TALDOR/TALH/TAL-H
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Transaldolase (TALDO1) ELISA Kit |
abx570176-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Transaldolase (TALDO1) ELISA Kit |
SEB371Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transaldolase (TALDO1) ELISA Kit |
SEB371Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transaldolase (TALDO1) ELISA Kit |
SEB371Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transaldolase (TALDO1) ELISA Kit |
SEB371Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Transaldolase (TALDO1) ELISA Kit |
4-SEB371Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Transaldolase elisa. Alternative names of the recognized antigen: TAL
- TALDO
- TALDOR
- Transaldolase 1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transaldolase (TALDO1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Transaldolase (TALDO1) ELISA Kit |
abx572386-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Cow Transaldolase (TALDO1) ELISA Kit |
abx512162-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Transaldolase (TALDO1) ELISA Kit |
abx512164-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Pig Transaldolase (TALDO1) ELISA Kit |
abx512165-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Transaldolase (TALDO1) Antibody |
20-abx005186 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Transaldolase (TALDO1) Antibody |
20-abx178642 |
Abbexa |
|
|
|
Transaldolase (TALDO1) Antibody |
20-abx178643 |
Abbexa |
|
|
|
Transaldolase (TALDO1) Antibody |
20-abx101410 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Transaldolase (TALDO1) Antibody |
20-abx110657 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transaldolase (TALDO1) Antibody |
20-abx141908 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Transaldolase (TALDO1) Antibody |
20-abx174856 |
Abbexa |
|
|
|
Transaldolase (TALDO1) Antibody |
abx032929-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Transaldolase (TALDO1) Antibody |
abx032929-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Transaldolase (TALDO1) Antibody |
abx238494-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Transaldolase (TALDO1) Antibody |
20-abx241929 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transaldolase (TALDO1) Antibody |
20-abx241930 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Transaldolase (TALDO1) |
4-RPB371Mu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q93092
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.1kDa
- Isoelectric Point: 7.8
|
Description: Recombinant Mouse Transaldolase expressed in: E.coli |
ELISA kit for Human TALDO1 (Transaldolase) |
ELK1901 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transaldolase (TALDO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transaldola
- Show more
|
Description: A sandwich ELISA kit for detection of Transaldolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Transaldolase (TALDO1) |
KTE60464-48T |
Abbkine |
48T |
EUR 332 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transaldolase (TALDO1) |
KTE60464-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Transaldolase (TALDO1) |
KTE60464-96T |
Abbkine |
96T |
EUR 539 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Transaldolase (TALDO1) CLIA Kit |
20-abx492701 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Transaldolase (TALDO1) Protein |
20-abx655278 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
ELISA kit for Rat Transaldolase (TALDO1) |
KTE100179-48T |
Abbkine |
48T |
EUR 332 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Transaldolase (TALDO1) |
KTE100179-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Transaldolase (TALDO1) |
KTE100179-96T |
Abbkine |
96T |
EUR 539 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transaldolase (TALDO1) |
KTE10093-48T |
Abbkine |
48T |
EUR 354 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transaldolase (TALDO1) |
KTE10093-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Transaldolase (TALDO1) |
KTE10093-96T |
Abbkine |
96T |
EUR 572 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Transaldolase (TALDO1) |
KTE80030-48T |
Abbkine |
48T |
EUR 354 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Transaldolase (TALDO1) |
KTE80030-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Pig Transaldolase (TALDO1) |
KTE80030-96T |
Abbkine |
96T |
EUR 572 |
- Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
- Show more
|
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transaldolase (TALDO1) |
KTE70332-48T |
Abbkine |
48T |
EUR 332 |
- Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transaldolase (TALDO1) |
KTE70332-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Transaldolase (TALDO1) |
KTE70332-96T |
Abbkine |
96T |
EUR 539 |
- Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Transaldolase (TALDO1) Antibody Pair |
abx117467-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Mouse Transaldolase (TALDO1) Protein |
20-abx069394 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Transaldolase (TALDO1) Protein |
20-abx655279 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
TALDO1 Transaldolase Human Recombinant Protein |
PROTP37837 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: TALDO1 Human Recombinant protein produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 357 amino acids (1-337) and having a molecular mass of 39.7 kDa. TALDO1 is fused to 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques. |
Transaldolase 1 (TALDO1) polyclonal antibody |
ABP-PAB-11692 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
Recombinant Human Transaldolase/TALDO1 (C-6His) |
C837-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0. |
Recombinant Human Transaldolase/TALDO1 (C-6His) |
C837-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0. |
Recombinant Human Transaldolase/TALDO1 (C-6His) |
C837-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0. |
Recombinant Human Transaldolase/TALDO1 (C-6His) |
C837-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0. |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse) |
4-PAB371Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1) |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), APC |
4-PAB371Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with APC. |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), Biotinylated |
4-PAB371Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with Biotin. |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), Cy3 |
4-PAB371Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with Cy3. |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), FITC |
4-PAB371Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with FITC. |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), HRP |
4-PAB371Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with HRP. |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), PE |
4-PAB371Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with PE. |
Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), APC-Cy7 |
4-PAB371Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TALDO1 (Asp35~Glu285)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with APC-Cy7. |
ELISA kit for Human Transaldolase |
EK1473 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transaldolase in samples from serum, plasma, tissue homogenates and other biological fluids. |
TALDO1 ELISA Kit (Human) (OKCD07365) |
OKCD07365 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Recombinant Human Transaldolase;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL |
TALDO1 ELISA Kit (Human) (OKEH04154) |
OKEH04154 |
Aviva Systems Biology |
96 Wells |
EUR 1014 |
Description: Description of target: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
Recombinant Human Transaldolase |
7-03628 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Transaldolase |
7-03629 |
CHI Scientific |
25µg |
Ask for price |
Recombinant Human Transaldolase |
7-03630 |
CHI Scientific |
1mg |
Ask for price |
TALDO1 ELISA Kit (Mouse) (OKEH05906) |
OKEH05906 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL |
TALDO1 ELISA Kit (Rat) (OKEH07179) |
OKEH07179 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL |
Transaldolase antibody |
70R-15401 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Transaldolase antibody |
Transaldolase (Recombinant) |
20-abx073275 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TALDO1 antibody |
70R-20701 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TALDO1 antibody |
TALDO1 antibody |
39160-100ul |
SAB |
100ul |
EUR 252 |
TALDO1 Antibody |
42784-100ul |
SAB |
100ul |
EUR 252 |
TALDO1 Antibody |
1-CSB-PA977634 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
TALDO1 Antibody |
DF12764 |
Affbiotech |
200ul |
EUR 304 |
Description: TALDO1 Antibody detects endogenous levels of TALDO1. |
TALDO1 Antibody |
1-CSB-PA04275A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
TALDO1 Antibody |
1-CSB-PA217736 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
TALDO1 Antibody |
1-CSB-PA023112GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
TALDO1 siRNA |
20-abx905451 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TALDO1 siRNA |
20-abx936008 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TALDO1 siRNA |
20-abx936009 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transaldolase antibody (FITC) |
60R-1996 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Transaldolase antibody (FITC) |
Transaldolase antibody (biotin) |
60R-1997 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Transaldolase antibody (biotin) |
Transaldolase antibody (HRP) |
60R-2009 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal Transaldolase antibody (HRP) |
Transaldolase Polyclonal Antibody |
42412-100ul |
SAB |
100ul |
EUR 333 |
Transaldolase Antibody (Biotin) |
20-abx106393 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transaldolase Antibody (FITC) |
20-abx107805 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Transaldolase Antibody (HRP) |
20-abx109223 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
anti-Transaldolase 1 |
YF-PA14912 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Transaldolase 1 |
anti-Transaldolase 1 |
YF-PA14913 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to Transaldolase 1 |
anti-Transaldolase 1 |
YF-PA14914 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Transaldolase 1 |
Human TALDO1 shRNA Plasmid |
20-abx954717 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TALDO1 Recombinant Protein (Human) |
RP030898 |
ABM |
100 ug |
Ask for price |
TALDO1 Recombinant Protein (Human) |
RP030901 |
ABM |
100 ug |
Ask for price |
TALDO1 Rabbit pAb |
A13551-100ul |
Abclonal |
100 ul |
EUR 308 |
TALDO1 Rabbit pAb |
A13551-200ul |
Abclonal |
200 ul |
EUR 459 |
TALDO1 Rabbit pAb |
A13551-20ul |
Abclonal |
20 ul |
EUR 183 |
TALDO1 Rabbit pAb |
A13551-50ul |
Abclonal |
50 ul |
EUR 223 |
TALDO1 Blocking Peptide |
DF12764-BP |
Affbiotech |
1mg |
EUR 195 |
TALDO1 Conjugated Antibody |
C42784 |
SAB |
100ul |
EUR 397 |
TALDO1 Conjugated Antibody |
C39160 |
SAB |
100ul |
EUR 397 |
TALDO1 cloning plasmid |
CSB-CL023112HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1014
- Sequence: atgtcgagctcacccgtgaagcgtcagaggatggagtccgcgctggaccagctcaagcagttcaccaccgtggtggccgacacgggcgacttccacgccatcgacgagtacaagccccaggatgctaccaccaacccgtccctgatcctggccgcagcacagatgcccgcttacc
- Show more
|
Description: A cloning plasmid for the TALDO1 gene. |
TALDO1 cloning plasmid |
CSB-CL023112HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 957
- Sequence: atgtcgagctcacccgtgaagcgtcagaggatggagtccgcgctggaccagctcaagcagttcaccaccgtggtggccgacacgggcgacttccacgccatcgacgagtacaagccccaggatgctaccaccaacccgtccctgatcctggccgcagcacagatgcccgcttacca
- Show more
|
Description: A cloning plasmid for the TALDO1 gene. |
TALDO1 Rabbit pAb |
A6762-100ul |
Abclonal |
100 ul |
EUR 308 |
TALDO1 Rabbit pAb |
A6762-200ul |
Abclonal |
200 ul |
EUR 459 |
TALDO1 Rabbit pAb |
A6762-20ul |
Abclonal |
20 ul |
EUR 183 |
TALDO1 Rabbit pAb |
A6762-50ul |
Abclonal |
50 ul |
EUR 223 |
TALDO1 Polyclonal Antibody |
A51941 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
anti- TALDO1 antibody |
FNab08494 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: transaldolase 1
- Uniprot ID: P37837
- Gene ID: 6888
- Research Area: Metabolism
|
Description: Antibody raised against TALDO1 |
Anti-TALDO1 antibody |
STJ28845 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis. |
Anti-TALDO1 antibody |
STJ115512 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis. |
Transaldolase 1 Polyclonal Antibody |
20-abx116938 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Transaldolase Polyclonal Conjugated Antibody |
C42412 |
SAB |
100ul |
EUR 397 |
TALDO1 ORF Vector (Human) (pORF) |
ORF010300 |
ABM |
1.0 ug DNA |
EUR 95 |
TALDO1 ORF Vector (Human) (pORF) |
ORF010301 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Polyclonal TALDO1 Antibody (Center) |
APR10377G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TALDO1 (Center). This antibody is tested and proven to work in the following applications: |
TALDO1 Antibody, HRP conjugated |
1-CSB-PA04275B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TALDO1 Antibody, FITC conjugated |
1-CSB-PA04275C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TALDO1 Antibody, Biotin conjugated |
1-CSB-PA04275D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
TALDO1 protein (His tag) |
80R-1428 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human TALDO1 protein |
Mouse TALDO1 shRNA Plasmid |
20-abx972990 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat TALDO1 shRNA Plasmid |
20-abx986834 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TALDO1 Recombinant Protein (Rat) |
RP232223 |
ABM |
100 ug |
Ask for price |
TALDO1 Recombinant Protein (Mouse) |
RP177176 |
ABM |
100 ug |
Ask for price |
TALDO1 sgRNA CRISPR Lentivector set (Human) |
K2330801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Escherichia coli Transaldolase B (talB) |
1-CSB-EP359086ENV |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 42.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Escherichia coli Transaldolase B(talB) expressed in E.coli |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Recombinant Human Transaldolase Protein, GST, E.coli-100ug |
QP8473-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human Transaldolase Protein, GST, E.coli-10ug |
QP8473-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human Transaldolase Protein, GST, E.coli-1mg |
QP8473-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human Transaldolase Protein, GST, E.coli-200ug |
QP8473-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human Transaldolase Protein, GST, E.coli-500ug |
QP8473-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human Transaldolase Protein, GST, E.coli-50ug |
QP8473-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
TALDO1 Polyclonal Antibody, HRP Conjugated |
A57608 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
TALDO1 Polyclonal Antibody, FITC Conjugated |
A57609 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
TALDO1 Polyclonal Antibody, Biotin Conjugated |
A57610 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Taldo1 ORF Vector (Rat) (pORF) |
ORF077409 |
ABM |
1.0 ug DNA |
EUR 506 |
m Taldo1 inducible lentiviral particles |
LVP538 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing mouse target: Taldo1 (transaldolase 1), [alternative names: None]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_011528.4. It also contains a RFP-Blasticidin dual selection marker. |
Taldo1 ORF Vector (Mouse) (pORF) |
ORF059060 |
ABM |
1.0 ug DNA |
EUR 506 |
TALDO1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2330802 |
ABM |
1.0 ug DNA |
EUR 154 |
TALDO1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2330803 |
ABM |
1.0 ug DNA |
EUR 154 |
TALDO1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2330804 |
ABM |
1.0 ug DNA |
EUR 154 |
TALDO1 Protein Vector (Human) (pPB-C-His) |
PV041197 |
ABM |
500 ng |
EUR 329 |
TALDO1 Protein Vector (Human) (pPB-N-His) |
PV041198 |
ABM |
500 ng |
EUR 329 |
TALDO1 Protein Vector (Human) (pPM-C-HA) |
PV041199 |
ABM |
500 ng |
EUR 329 |
TALDO1 Protein Vector (Human) (pPM-C-His) |
PV041200 |
ABM |
500 ng |
EUR 329 |
TALDO1 Protein Vector (Human) (pPB-C-His) |
PV041201 |
ABM |
500 ng |
EUR 329 |
TALDO1 Protein Vector (Human) (pPB-N-His) |
PV041202 |
ABM |
500 ng |
EUR 329 |
TALDO1 Protein Vector (Human) (pPM-C-HA) |
PV041203 |
ABM |
500 ng |
EUR 329 |
TALDO1 Protein Vector (Human) (pPM-C-His) |
PV041204 |
ABM |
500 ng |
EUR 329 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
TALDO1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV715653 |
ABM |
1.0 ug DNA |
EUR 316 |
TALDO1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV715657 |
ABM |
1.0 ug DNA |
EUR 316 |
TALDO1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV715658 |
ABM |
1.0 ug DNA |
EUR 316 |
vWF Acty. Kit |
ABP-ACT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 428 |
vWF Ant. Kit |
ABP-TOT-KIT |
Abpcorp |
12 x 8 microwells |
EUR 394 |
Taldo1 sgRNA CRISPR Lentivector set (Rat) |
K7103201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Taldo1 sgRNA CRISPR Lentivector set (Mouse) |
K3983901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320) |
VAng-Lsx4263-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3677 |
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein. |
Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320) |
VAng-Lsx4263-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2495 |
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein. |
Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320) |
VAng-Lsx4263-50gEcoli |
Creative Biolabs |
50 µg (E. coli) |
EUR 1700 |
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein. |
hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9) |
CAS620A-KIT |
SBI |
1 kit |
EUR 2152 |
|
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression) |
Human TALDO1(Transaldolase) ELISA Kit