Human TALDO1(Transaldolase) ELISA Kit

Human Transaldolase (TALDO1) ELISA Kit

RD-TALDO1-Hu-48Tests 48 Tests
EUR 500

Human Transaldolase (TALDO1) ELISA Kit

RD-TALDO1-Hu-96Tests 96 Tests
EUR 692

Human Transaldolase (TALDO1) ELISA Kit

RDR-TALDO1-Hu-48Tests 48 Tests
EUR 522

Human Transaldolase (TALDO1) ELISA Kit

RDR-TALDO1-Hu-96Tests 96 Tests
EUR 724

Human Transaldolase (TALDO1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 63.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transaldolase(TALDO1),partial expressed in E.coli

Human Transaldolase (TALDO1) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transaldolase (TALDO1) ELISA Kit

abx253719-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human TALDO1/ Transaldolase ELISA Kit

E2442Hu 1 Kit
EUR 571

Human TALDO1(Transaldolase) ELISA Kit

EH0761 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P37837
  • Alias: TALDO1(Transaldolase)/TAL/TALDOR/TALH/TAL-H
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Transaldolase (TALDO1) ELISA Kit

abx570176-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Transaldolase (TALDO1) ELISA Kit

SEB371Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit

SEB371Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit

SEB371Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit

SEB371Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transaldolase (TALDO1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transaldolase (TALDO1) in serum, plasma, tissue homogenates and other biological fluids.

Human Transaldolase (TALDO1) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transaldolase elisa. Alternative names of the recognized antigen: TAL
  • Transaldolase 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transaldolase (TALDO1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Transaldolase (TALDO1) ELISA Kit

abx572386-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Cow Transaldolase (TALDO1) ELISA Kit

abx512162-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Transaldolase (TALDO1) ELISA Kit

abx512164-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Transaldolase (TALDO1) ELISA Kit

abx512165-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Transaldolase (TALDO1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody

  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transaldolase (TALDO1) Antibody

  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transaldolase (TALDO1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transaldolase (TALDO1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transaldolase (TALDO1) Antibody

abx032929-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody

abx032929-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody

abx238494-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Transaldolase (TALDO1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transaldolase (TALDO1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Transaldolase (TALDO1)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q93092
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.1kDa
  • Isoelectric Point: 7.8
Description: Recombinant Mouse Transaldolase expressed in: E.coli

ELISA kit for Human TALDO1 (Transaldolase)

ELK1901 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transaldolase (TALDO1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transaldola
  • Show more
Description: A sandwich ELISA kit for detection of Transaldolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Transaldolase (TALDO1)

KTE60464-48T 48T
EUR 332
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transaldolase (TALDO1)

KTE60464-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Transaldolase (TALDO1)

KTE60464-96T 96T
EUR 539
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Transaldolase (TALDO1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Transaldolase (TALDO1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Rat Transaldolase (TALDO1)

KTE100179-48T 48T
EUR 332
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transaldolase (TALDO1)

KTE100179-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Transaldolase (TALDO1)

KTE100179-96T 96T
EUR 539
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transaldolase (TALDO1)

KTE10093-48T 48T
EUR 354
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transaldolase (TALDO1)

KTE10093-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Transaldolase (TALDO1)

KTE10093-96T 96T
EUR 572
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transaldolase (TALDO1)

KTE80030-48T 48T
EUR 354
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transaldolase (TALDO1)

KTE80030-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Transaldolase (TALDO1)

KTE80030-96T 96T
EUR 572
  • Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sul
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transaldolase (TALDO1)

KTE70332-48T 48T
EUR 332
  • Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transaldolase (TALDO1)

KTE70332-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transaldolase (TALDO1)

KTE70332-96T 96T
EUR 539
  • Taldo1 encodes a key enzyme of the nonoxidative pentose phosphate pathway that provides ribose-5-phosphate for nucleic acid synthesis and nicotinamide adenine dinucleotide phosphate (NADPH) for lipid biosynthesis. The encoded protein is important for
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transaldolase (TALDO1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Transaldolase (TALDO1) Antibody Pair

abx117467-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Mouse Transaldolase (TALDO1) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Transaldolase (TALDO1) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

TALDO1 Transaldolase Human Recombinant Protein

PROTP37837 Regular: 25ug
EUR 317
Description: TALDO1 Human Recombinant protein produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 357 amino acids (1-337) and having a molecular mass of 39.7 kDa. TALDO1 is fused to 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques.

Transaldolase 1 (TALDO1) polyclonal antibody

ABP-PAB-11692 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Recombinant Human Transaldolase/TALDO1 (C-6His)

C837-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Recombinant Human Transaldolase/TALDO1 (C-6His)

C837-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Recombinant Human Transaldolase/TALDO1 (C-6His)

C837-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Recombinant Human Transaldolase/TALDO1 (C-6His)

C837-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 10% Glycerol, pH 8.0.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1)

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with APC.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with Biotin.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with Cy3.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with FITC.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with HRP.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with PE.

Transaldolase (TALDO1) Polyclonal Antibody (Human, Rat, Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TALDO1 (Asp35~Glu285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Mouse Transaldolase (TALDO1). This antibody is labeled with APC-Cy7.


ELA-E0198h 96 Tests
EUR 824


EF000491 96 Tests
EUR 689

ELISA kit for Human Transaldolase

EK1473 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Transaldolase in samples from serum, plasma, tissue homogenates and other biological fluids.

TALDO1 ELISA Kit (Human) (OKCD07365)

OKCD07365 96 Wells
EUR 936
Description: Description of target: Recombinant Human Transaldolase;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

TALDO1 ELISA Kit (Human) (OKEH04154)

OKEH04154 96 Wells
EUR 1014
Description: Description of target: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Recombinant Human Transaldolase

7-03628 5µg Ask for price

Recombinant Human Transaldolase

7-03629 25µg Ask for price

Recombinant Human Transaldolase

7-03630 1mg Ask for price

TALDO1 ELISA Kit (Mouse) (OKEH05906)

OKEH05906 96 Wells
EUR 662
Description: Description of target: Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

TALDO1 ELISA Kit (Rat) (OKEH07179)

OKEH07179 96 Wells
EUR 662
Description: Description of target: Transaldolase is important for the balance of metabolites in the pentose-phosphate pathway.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Transaldolase antibody

70R-15401 100 ug
EUR 327
Description: Rabbit polyclonal Transaldolase antibody

Transaldolase (Recombinant)

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

TALDO1 antibody

70R-20701 50 ul
EUR 435
Description: Rabbit polyclonal TALDO1 antibody

TALDO1 antibody

39160-100ul 100ul
EUR 252

TALDO1 Antibody

42784-100ul 100ul
EUR 252

TALDO1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TALDO1 Antibody

DF12764 200ul
EUR 304
Description: TALDO1 Antibody detects endogenous levels of TALDO1.

TALDO1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

TALDO1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TALDO1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Transaldolase antibody (FITC)

60R-1996 100 ug
EUR 327
Description: Rabbit polyclonal Transaldolase antibody (FITC)

Transaldolase antibody (biotin)

60R-1997 100 ug
EUR 327
Description: Rabbit polyclonal Transaldolase antibody (biotin)

Transaldolase antibody (HRP)

60R-2009 100 ug
EUR 327
Description: Rabbit polyclonal Transaldolase antibody (HRP)

Transaldolase Polyclonal Antibody

42412-100ul 100ul
EUR 333

Transaldolase Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transaldolase Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Transaldolase Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti-Transaldolase 1

YF-PA14912 50 ug
EUR 363
Description: Mouse polyclonal to Transaldolase 1

anti-Transaldolase 1

YF-PA14913 100 ul
EUR 403
Description: Rabbit polyclonal to Transaldolase 1

anti-Transaldolase 1

YF-PA14914 100 ug
EUR 403
Description: Rabbit polyclonal to Transaldolase 1

Human TALDO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TALDO1 Recombinant Protein (Human)

RP030898 100 ug Ask for price

TALDO1 Recombinant Protein (Human)

RP030901 100 ug Ask for price

TALDO1 Rabbit pAb

A13551-100ul 100 ul
EUR 308

TALDO1 Rabbit pAb

A13551-200ul 200 ul
EUR 459

TALDO1 Rabbit pAb

A13551-20ul 20 ul
EUR 183

TALDO1 Rabbit pAb

A13551-50ul 50 ul
EUR 223

TALDO1 Blocking Peptide

DF12764-BP 1mg
EUR 195

TALDO1 Conjugated Antibody

C42784 100ul
EUR 397

TALDO1 Conjugated Antibody

C39160 100ul
EUR 397

TALDO1 cloning plasmid

CSB-CL023112HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1014
  • Sequence: atgtcgagctcacccgtgaagcgtcagaggatggagtccgcgctggaccagctcaagcagttcaccaccgtggtggccgacacgggcgacttccacgccatcgacgagtacaagccccaggatgctaccaccaacccgtccctgatcctggccgcagcacagatgcccgcttacc
  • Show more
Description: A cloning plasmid for the TALDO1 gene.

TALDO1 cloning plasmid

CSB-CL023112HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 957
  • Sequence: atgtcgagctcacccgtgaagcgtcagaggatggagtccgcgctggaccagctcaagcagttcaccaccgtggtggccgacacgggcgacttccacgccatcgacgagtacaagccccaggatgctaccaccaacccgtccctgatcctggccgcagcacagatgcccgcttacca
  • Show more
Description: A cloning plasmid for the TALDO1 gene.

TALDO1 Rabbit pAb

A6762-100ul 100 ul
EUR 308

TALDO1 Rabbit pAb

A6762-200ul 200 ul
EUR 459

TALDO1 Rabbit pAb

A6762-20ul 20 ul
EUR 183

TALDO1 Rabbit pAb

A6762-50ul 50 ul
EUR 223

TALDO1 Polyclonal Antibody

A51941 100 µg
EUR 570.55
Description: Ask the seller for details

anti- TALDO1 antibody

FNab08494 100µg
EUR 548.75
  • Immunogen: transaldolase 1
  • Uniprot ID: P37837
  • Gene ID: 6888
  • Research Area: Metabolism
Description: Antibody raised against TALDO1

Anti-TALDO1 antibody

PAab08494 100 ug
EUR 386

Anti-TALDO1 antibody

STJ28845 100 µl
EUR 277
Description: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis.

Anti-TALDO1 antibody

STJ115512 100 µl
EUR 277
Description: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis.

Transaldolase 1 Polyclonal Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transaldolase Polyclonal Conjugated Antibody

C42412 100ul
EUR 397

TALDO1 ORF Vector (Human) (pORF)

ORF010300 1.0 ug DNA
EUR 95

TALDO1 ORF Vector (Human) (pORF)

ORF010301 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Polyclonal TALDO1 Antibody (Center)

APR10377G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TALDO1 (Center). This antibody is tested and proven to work in the following applications:

TALDO1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TALDO1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TALDO1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TALDO1. Recognizes TALDO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TALDO1 protein (His tag)

80R-1428 100 ug
EUR 305
Description: Purified recombinant Human TALDO1 protein

Mouse TALDO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TALDO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TALDO1 Recombinant Protein (Rat)

RP232223 100 ug Ask for price

TALDO1 Recombinant Protein (Mouse)

RP177176 100 ug Ask for price

TALDO1 sgRNA CRISPR Lentivector set (Human)

K2330801 3 x 1.0 ug
EUR 339

Escherichia coli Transaldolase B (talB)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Escherichia coli Transaldolase B(talB) expressed in E.coli

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Recombinant Human Transaldolase Protein, GST, E.coli-100ug

QP8473-ec-100ug 100ug
EUR 408

Recombinant Human Transaldolase Protein, GST, E.coli-10ug

QP8473-ec-10ug 10ug
EUR 200

Recombinant Human Transaldolase Protein, GST, E.coli-1mg

QP8473-ec-1mg 1mg
EUR 1632

Recombinant Human Transaldolase Protein, GST, E.coli-200ug

QP8473-ec-200ug 200ug
EUR 634

Recombinant Human Transaldolase Protein, GST, E.coli-500ug

QP8473-ec-500ug 500ug
EUR 1060

Recombinant Human Transaldolase Protein, GST, E.coli-50ug

QP8473-ec-50ug 50ug
EUR 263

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

TALDO1 Polyclonal Antibody, HRP Conjugated

A57608 100 µg
EUR 570.55
Description: fast delivery possible

TALDO1 Polyclonal Antibody, FITC Conjugated

A57609 100 µg
EUR 570.55
Description: reagents widely cited

TALDO1 Polyclonal Antibody, Biotin Conjugated

A57610 100 µg
EUR 570.55
Description: Ask the seller for details

Taldo1 ORF Vector (Rat) (pORF)

ORF077409 1.0 ug DNA
EUR 506

m Taldo1 inducible lentiviral particles

LVP538 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing mouse target: Taldo1 (transaldolase 1), [alternative names: None]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_011528.4. It also contains a RFP-Blasticidin dual selection marker.

Taldo1 ORF Vector (Mouse) (pORF)

ORF059060 1.0 ug DNA
EUR 506

TALDO1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2330802 1.0 ug DNA
EUR 154

TALDO1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2330803 1.0 ug DNA
EUR 154

TALDO1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2330804 1.0 ug DNA
EUR 154

TALDO1 Protein Vector (Human) (pPB-C-His)

PV041197 500 ng
EUR 329

TALDO1 Protein Vector (Human) (pPB-N-His)

PV041198 500 ng
EUR 329

TALDO1 Protein Vector (Human) (pPM-C-HA)

PV041199 500 ng
EUR 329

TALDO1 Protein Vector (Human) (pPM-C-His)

PV041200 500 ng
EUR 329

TALDO1 Protein Vector (Human) (pPB-C-His)

PV041201 500 ng
EUR 329

TALDO1 Protein Vector (Human) (pPB-N-His)

PV041202 500 ng
EUR 329

TALDO1 Protein Vector (Human) (pPM-C-HA)

PV041203 500 ng
EUR 329

TALDO1 Protein Vector (Human) (pPM-C-His)

PV041204 500 ng
EUR 329

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

TALDO1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV715653 1.0 ug DNA
EUR 316

TALDO1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV715657 1.0 ug DNA
EUR 316

TALDO1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV715658 1.0 ug DNA
EUR 316

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Taldo1 sgRNA CRISPR Lentivector set (Rat)

K7103201 3 x 1.0 ug
EUR 339

Taldo1 sgRNA CRISPR Lentivector set (Mouse)

K3983901 3 x 1.0 ug
EUR 339

Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320)

VAng-Lsx4263-1mgEcoli 1 mg (E. coli)
EUR 3677
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein.

Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320)

VAng-Lsx4263-500gEcoli 500 µg (E. coli)
EUR 2495
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein.

Recombinant Bordetella Bronchiseptica Transaldolase (aa 1-320)

VAng-Lsx4263-50gEcoli 50 µg (E. coli)
EUR 1700
Description: Bordetella Bronchiseptica Transaldolase, recombinant protein.

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

Human TALDO1(Transaldolase) ELISA Kit